CD79B (NM_001039933) Human Untagged Clone

SKU
SC311082
CD79B (untagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3
$300.00
5 Days*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD79B
Synonyms AGM6; B29; IGB
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001039933 edited
CAGAGCGGTGACCATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGC
GTTGCTGCTGCTGCTCTCAGCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGGTA
CCGGAATCCCAAAGGTAGTGCTTGTTCGCGGATCTGGCAGAGCCCACGTTTCATAGCCAG
GAAACGGGGCTTCACGGTGAAAATGCACTGCTACATGAACAGCGCCTCCGGCAATGTGAG
CTGGCTCTGGAAGCAGGAGATGGACGAGAATCCCCAGCAGCTGAAGCTGGAAAAGGGCCG
CATGGAAGAGTCCCAGAACGAATCTCTCGCCACCCTCACCATCCAAGGCATCCGGTTTGA
GGACAATGGCATCTACTTCTGCCAGCAGAAGTGCAACAACACCTCGGAGGTCTACCAGGG
CTGCGGCACAGAGCTGCGAGTCATGGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAA
CACGCTGAAGGATGGTATCATCATGATCCAGACGCTGCTGATCATCCTCTTCATCATCGT
GCCTATCTTCCTGCTGCTGGACAAGGATGACAGCAAGGCTGGCATGGAGGAAGATCACAC
CTACGAGGGCCTGGACATTGACCAGACAGCCACCTATGAGGACATAGTGACGCTGCGGAC
AGGGGAAGTGAAGTGGTCTGTAGGTGAGCACCCAGGCCAGGAGTGAGAGCCAGGTCGCCC
CATGACCTGGGTGCAGGCTCCCTGGCCTCAGTGACTGCTTCGGAGCTGCCTGGCTCATGG
CCCAACCCCTTTCCCGGACCCCCCAGCTGGCCTCTGAAGCTGGCCCACCAGAGCTGCCAT
TTGTCTCCAGCCCCTGGTCCCCAGCTCTTGCCAAAGGGCCTGGAGTAGAAGGACAACAGG
GCAGCAACTTGGAGGGAGTTCTCTGGGGATGGACGGGACCCAGCCTTCTGGGGGTGCTAT
GAGGTGATCCGTCCCCACACATGGGATGGGGGAGGCAGAGACTGGTCCAGAGCCCGCAAA
TGGACTCGGAGCCGAGGGCCTCCCAGCAGAGCTTGGGAAGGGCCATGGACCCAACTGGGC
CCCAGAAGAGCCACAGGAACATCATTCCTCTCCCGCAACCACTCCCACCCCAGGGAGGCC
CTGGCCTCCAGTGCCTTCCCCCGTGGAATAAACGGTGTGTCCTGAGAAACCAAAAAAAAA
AAAAAA
Restriction Sites Please inquire
ACCN NM_001039933
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001039933.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039933.1, NP_001035022.1
RefSeq Size 1303 bp
RefSeq ORF 693 bp
Locus ID 974
UniProt ID P40259
Cytogenetics 17q23.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways B cell receptor signaling pathway
Summary The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (3).
Write Your Own Review
You're reviewing:CD79B (NM_001039933) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200665 CD79B (Myc-DDK-tagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3 10 ug
$457.00
RC200665L1 Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC200665L2 Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, mGFP tagged 10 ug
$757.00
RC200665L3 Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC200665L4 Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, mGFP tagged 10 ug
$757.00
RG200665 CD79B (tGFP-tagged) - Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC321002 CD79B (untagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.