MRPS18C (NM_016067) Human Untagged Clone

SKU
SC310669
MRPS18C (untagged)-Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MRPS18C
Synonyms CGI-134; MRP-S18-1; MRP-S18-c; MRPS18-1; mrps18-c; S18mt-c
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016067 edited
GATTTGGAACGAAAGGGAGTGGAAGAAACGCGGAACCATGGCCGCTGTGGTTGCTGTTTG
CGGTGGTCTAGGGAGGAAGAAGTTGACACACTTGGTAACGGCTGCTGTCAGCCTTACACA
TCCCGGGACTCACACGGTGCTTTGGAGAAGAGGTTGTTCACAACAGGTATCCAGCAATGA
GGACCTGCCCATTTCAATGGAAAATCCTTATAAAGAACCTCTTAAGAAATGTATCTTGTG
TGGAAAGCATGTAGATTATAAGAATGTACAGCTTTTGTCCCAGTTTGTTTCTCCATTTAC
TGGATGCATTTATGGAAGGCACATTACAGGTCTTTGTGGGAAGAAACAGAAAGAAATCAC
AAAAGCAATTAAGAGAGCTCAAATAATGGGGTTTATGCCAGTTACATACAAGGATCCTGC
ATATCTCAAGGACCCTAAAGTTTGTAACATCAGATATCGGGAATAAATTCTATCACGTTA
CCACTAATAAACTTATTTTACAGTAAGTGGTTGTATGATGCCAATACTGACTCAAACCAA
CCTTTGGATAGAAAAGTGTTTGAGGAGTGAGGTAAAGAATGACACTTCCCCTTCATACCA
ATGTCCATTAAGCAGATTGCTTATTTAAAATGTTAACACTCATCACATTTTATCTATGTT
GAATAAAAGTGGTTCTGTGTGATTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_016067
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_016067.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016067.1, NP_057151.1
RefSeq Size 1014 bp
RefSeq ORF 429 bp
Locus ID 51023
UniProt ID Q9Y3D5
Cytogenetics 4q21.23
Domains Ribosomal_S18
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. Pseudogenes corresponding to this gene are found on chromosomes 8p, 12p, 15q, and 22q. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:MRPS18C (NM_016067) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202659 MRPS18C (Myc-DDK-tagged)-Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein 10 ug
$150.00
RC202659L3 Lenti ORF clone of Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$450.00
RC202659L4 Lenti ORF clone of Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$450.00
RG202659 MRPS18C (tGFP-tagged) - Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein 10 ug
$350.00
SC320819 MRPS18C (untagged)-Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.