OTUD4 (NM_017493) Human Untagged Clone

SKU
SC310667
OTUD4 (untagged)-Human OTU domain containing 4 (OTUD4), transcript variant 2
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol OTUD4
Synonyms DUBA6; HIN1; HSHIN1
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_017493, the custom clone sequence may differ by one or more nucleotides
ATGGCCTGTATTCACTATCTTCGAGAGAACAGAGAGAAATTTGAAGCGTTTATAGAAGGA
TCATTTGAAGAATATTTAAAGCGTTTGGAAAATCCACAGGAATGGGTAGGACAAGTGGAA
ATAAGTGCCCTTTCTCTTATGTACAGGAAAGATTTTATAATTTATCGGGAACCAAATGTT
TCTCCTTCACAAGTAACAGAAAATAATTTTCCTGAAAAGGTGTTACTGTGTTTTTCAAAT
GGAAATCATTATGATATTGTGTATCCCATAAAGTATAAAGAAAGCTCTGCTATGTGTCAG
TCTCTCCTTTATGAATTGCTGTATGAGAAGGTATTTAAAACTGATGTTAGTAAAATTGTG
ATGGAACTAGACACGTTGGAAGTAGCTGATGAAGATAACAGTGAAATATCAGATTCAGAG
GATGACAGTTGCAAGTAA
Restriction Sites Please inquire
ACCN NM_017493
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017493.4, NP_059963.1
RefSeq Size 864 bp
RefSeq ORF 846 bp
Locus ID 54726
UniProt ID Q01804
Cytogenetics 4q31.21
Domains OTU
Summary Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 3. The resulting isoform (2) is much shorter at the C-terminus compared to isoform 3.
Write Your Own Review
You're reviewing:OTUD4 (NM_017493) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214110 OTUD4 (Myc-DDK-tagged)-Human OTU domain containing 4 (OTUD4), transcript variant 2 10 ug
$165.00
RC214110L3 Lenti-ORF clone of OTUD4 (Myc-DDK-tagged)-Human OTU domain containing 4 (OTUD4), transcript variant 2 10 ug
$465.00
RC214110L4 Lenti-ORF clone of OTUD4 (mGFP-tagged)-Human OTU domain containing 4 (OTUD4), transcript variant 2 10 ug
$465.00
RG214110 OTUD4 (tGFP-tagged) - Human OTU domain containing 4 (OTUD4), transcript variant 2 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.