RSU1 (NM_152724) Human Untagged Clone

SKU
SC310615
RSU1 (untagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RSU1
Synonyms RSP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310615 representing NM_152724.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGCCACCGAACATCGCAGAACTGAAGAATTTGGAGGTGCTCAACTTTTTTAATAACCAAATCGAG
GAGCTGCCCACACAGATCAGTAGCCTTCAGAAACTCAAACACCTGAACCTTGGCATGAACAGGCTGAAC
ACTTTGCCACGAGGCTTCGGCTCCCTGCCAGCTCTTGAGGTTCTGGACTTGACGTACAACAACTTGAGC
GAAAATTCTCTTCCTGGAAACTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGAT
TTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGAC
CTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACCCAGCTTAAAGAGCTCCACATTCAGGGGAACCGC
CTCACCGTTCTGCCCCCAGAACTAGGAAACTTGGATTTAACTGGCCAGAAGCAGGTATTCAAAGCAGAG
AACAATCCCTGGGTGACCCCCATTGCAGACCAGTTCCAGCTTGGCGTGTCCCATGTTTTTGAGTATATC
CGTTCTGAGACATACAAATACCTCTACGGCAGACACATGCAGGCCAACCCAGAACCACCGAAGAAGAAT
AATGACAAATCGAAAAAGATCAGCCGGAAACCCCTGGCAGCCAAGAACAGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_152724
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152724.2
RefSeq Size 3657 bp
RefSeq ORF 675 bp
Locus ID 6251
UniProt ID Q15404
Cytogenetics 10p13
Protein Families Druggable Genome
MW 25.5 kDa
Summary This gene encodes a protein that is involved in the Ras signal transduction pathway, growth inhibition, and nerve-growth factor induced differentiation processes, as determined in mouse and human cell line studies. In mouse, the encoded protein was initially isolated based on its ability to inhibit v-Ras transformation. Multiple alternatively spliced transcript variants for this gene have been reported; one of these variants was found only in glioma tumors. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame segment in the 5' UTR and 5' coding region and uses a downstream start codon, compared to variant 1. It encodes isoform 2 which has a shorter N-terminus, compared to isoform 1. This transcript is supported by multiple ESTs, but the predicted ORF has not yet been experimentally confirmed.
Write Your Own Review
You're reviewing:RSU1 (NM_152724) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223579 RSU1 (Myc-DDK-tagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 2 10 ug
$300.00
RC223579L3 Lenti ORF clone of Human Ras suppressor protein 1 (RSU1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC223579L4 Lenti ORF clone of Human Ras suppressor protein 1 (RSU1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG223579 RSU1 (tGFP-tagged) - Human Ras suppressor protein 1 (RSU1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.