KCTD5 (NM_018992) Human Untagged Clone

SKU
SC310612
KCTD5 (untagged)-Human potassium channel tetramerisation domain containing 5 (KCTD5)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KCTD5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310612 representing NM_018992.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGAGAATCACTGCGAGCTCCTGTCGCCGGCCCGGGGCGGCATCGGGGCGGGGCTGGGGGGCGGC
CTGTGCCGCCGCTGCAGCGCTGGGCTCGGCGCCCTGGCCCAGCGCCCTGGCAGCGTGTCCAAGTGGGTC
CGACTCAACGTCGGCGGCACCTACTTCCTCACCACTCGGCAGACCCTGTGCCGGGACCCGAAATCCTTC
CTGTACCGCTTATGCCAGGCCGATCCCGACCTGGACTCAGACAAGGATGAAACAGGCGCCTATTTAATC
GACAGAGACCCCACCTACTTTGGGCCTGTGCTGAACTACCTGAGACACGGCAAGCTGGTGATTAACAAA
GACCTCGCGGAGGAAGGAGTGTTGGAGGAAGCAGAATTTTACAATATCACCTCATTAATAAAACTTGTA
AAGGACAAAATTAGAGAACGAGACAGCAAAACATCGCAGGTGCCTGTGAAGCATGTGTACCGTGTGCTG
CAGTGCCAGGAGGAGGAGCTCACGCAGATGGTGTCCACCATGTCCGACGGCTGGAAGTTCGAGCAGTTG
GTCAGCATCGGCTCCTCTTACAACTATGGGAACGAAGACCAAGCCGAGTTCCTCTGTGTGGTGTCCAAG
GAGCTGCACAACACCCCGTACGGTACGGCCAGCGAGCCCAGCGAGAAGGCCAAGATTTTGCAAGAACGA
GGCTCAAGGATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_018992
Insert Size 705 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018992.3
RefSeq Size 2479 bp
RefSeq ORF 705 bp
Locus ID 54442
UniProt ID Q9NXV2
Cytogenetics 16p13.3
Domains BTB, K_tetra
Protein Families Ion Channels: Other
MW 26.1 kDa
Summary Its interaction with CUL3 suggests that it may act as a substrate adapter in some E3 ligase complex (PubMed:18573101). Does not affect the function of Kv channel Kv2.1/KCNB1, Kv1.2/KCNA2, Kv4.2/KCND2 and Kv3.4/KCNC4 (PubMed:19361449).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:KCTD5 (NM_018992) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200180 KCTD5 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 5 (KCTD5) 10 ug
$300.00
RC200180L1 Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), Myc-DDK-tagged 10 ug
$600.00
RC200180L2 Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), mGFP tagged 10 ug
$600.00
RC200180L3 Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), Myc-DDK-tagged 10 ug
$600.00
RC200180L4 Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), mGFP tagged 10 ug
$600.00
RG200180 KCTD5 (tGFP-tagged) - Human potassium channel tetramerisation domain containing 5 (KCTD5) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC320723 KCTD5 (untagged)-Human potassium channel tetramerisation domain containing 5 (KCTD5) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.