CIAPIN1 (NM_020313) Human Untagged Clone

SKU
SC310484
CIAPIN1 (untagged)-Human cytokine induced apoptosis inhibitor 1 (CIAPIN1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CIAPIN1
Synonyms Anamorsin; CIAE2; DRE2; PRO0915
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310484 representing NM_020313.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGATTTTGGGATCTCTGCTGGCCAGTTTGTGGCAGTGGTCTGGGATAAGTCATCCCCAGTGGAG
GCTCTGAAAGGTCTGGTGGATAAGCTTCAAGCGTTAACCGGCAATGAGGGCCGCGTGTCTGTGGAAAAC
ATCAAGCAGCTGTTGCAATCTGCCCACAAAGAATCCAGCTTTGACATTATTTTGTCAGGTTTAGTCCCA
GGAAGCACCACTCTGCACAGTGCTGAGATTTTGGCTGAAATCGCCCGGATCCTTCGGCCTGGTGGATGT
CTTTTTCTGAAGGAGCCAGTAGAGACAGCTGTAGATAACAATAGCAAAGTGAAGACAGCATCTAAGCTG
TGTTCAGCCCTGACTCTTTCTGGTCTTGTGGAAGTGAAAGAGCTGCAGCGGGAGCCCCTAACCCCTGAG
GAAGTACAGTCTGTTCGAGAACACCTTGGTCATGAAAGTGACAACCTGCTGTTTGTTCAGATCACAGGC
AAAAAACCAAACTTTGAAGTGGGTTCTTCTAGGCAGCTTAAGCTTTCCATCACCAAGAAGTCTTCTCCT
TCAGTGAAACCTGCTGTGGACCCTGCTGCTGCCAAGCTGTGGACCCTCTCAGCCAACGATATGGAGGAC
GACAGCATGGATCTCATTGACTCAGATGAGCTGCTGGATCCAGAAGATTTGAAGAAGCCAGATCCAGCT
TCCCTGCGGGCTGCTTCTTGTGGGGAAGGGAAAAAGAGGAAGGCCTGTAAGAACTGCACCTGTGGCCTT
GCCGAAGAACTGGAAAAAGAGAAGTCAAGGGAACAGATGAGCTCCCAACCCAAGTCAGCTTGTGGAAAC
TGCTACCTGGGCGATGCCTTCCGCTGTGCCAGCTGCCCCTACCTTGGGATGCCAGCCTTCAAACCTGGG
GAAAAGGTGCTTCTGAGTGATAGCAATCTTCATGATGCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_020313
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020313.3
RefSeq Size 2199 bp
RefSeq ORF 939 bp
Locus ID 57019
UniProt ID Q6FI81
Cytogenetics 16q21
Domains DUF689
MW 33.6 kDa
Summary CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 (MIM 151430) or CASP (see MIM 147678) families. Expression of CIAPIN1 is dependent on growth factor stimulation (Shibayama et al., 2004 [PubMed 14970183]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:CIAPIN1 (NM_020313) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209626 CIAPIN1 (Myc-DDK-tagged)-Human cytokine induced apoptosis inhibitor 1 (CIAPIN1) 10 ug
$300.00
RC209626L3 Lenti ORF clone of Human cytokine induced apoptosis inhibitor 1 (CIAPIN1), Myc-DDK-tagged 10 ug
$600.00
RC209626L4 Lenti ORF clone of Human cytokine induced apoptosis inhibitor 1 (CIAPIN1), mGFP tagged 10 ug
$600.00
RG209626 CIAPIN1 (tGFP-tagged) - Human cytokine induced apoptosis inhibitor 1 (CIAPIN1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.