SUV420h1 (KMT5B) (NM_016028) Human Untagged Clone

SKU
SC310445
SUV420H1 (untagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SUV420h1
Synonyms CGI-85; CGI85; MRD51; SUV420H1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_016028 edited
ATGAAGTGGTTGGGAGAATCCGAGAACATGGTGGTGAATGGCAGGAGAAATGGAGGCAAG
TTGTCTAATGACCATCAGCAGAATCAATCAAAATTACAGCACACGGGGAAGGACACCCTG
AAGGCTGGCAAAAATGCAGTCGAGAGGAGGTCGAACAGATGTAATGGTAACTCGGGATTT
GAAGGACAGAGTCGCTATGTACCATCCTCTGGAATGTCCGCCAAGGAACTCTGTGAAAAT
GATGACCTAGCAACCAGTTTGGTTCTTGATCCCTATTTAGGTTTTCAAACACACAAAATG
AATACTAGCGCCTTTCCTTCGAGGAGCTCAAGGCATTTTTCAAAATCTGACAGTTTTTCT
CACAACAACCCTGTGAGATTTAGGCCTATTAAAGGAAGGCAGGAAGAACTAAAGGAAGTA
ATTGAACGTTTTAAGAAAGATGAACACTTGGAGAAAGCCTTCAAATGTTTGACTTCAGGC
GAATGGGCACGGCACTATTTTCTCAACAAGAATAAAATGCAGGAGAAATTATTCAAAGAA
CATGTATTTATTTATTTGCGAATGTTTGCAACTGACAGTGGATTTGAAATATTGCCATGT
AATAGATACTCATCAGAACAAAATGGAGCCAAAATAGTTGCAACAAAAGAGTGGAAACGA
AATGACAAAATAGAATTACTGGTGGGTTGTATTGCCGAACTTTCAGAAATTGAGGAGAAC
ATGCTACTTAGACATGGAGAAAACGACTTCAGTGTCATGTACTCCACAAGGAAAAACTGT
GCTCAACTCTGGCTGGGTCCTGCTGCGTTTATAAACCATGATTGCAGACCTAATTGTAAG
TTTGTGTCAACTGGTCGAGATACAGCATGTGTGAAGGCTCTAAGAGACATTGAACCTGGA
GAAGAAATTTCTTGTTATTATGGAGATGGGTTCTTTGGAGAAAATAATGAGTTCTGCGAG
TGTTACACTTGCGAAAGACGGGGCACTGGTGCTTTTAAATCCAGAGTGGGACTGCCTGCG
CCTGCTCCTGTTATCAATAGCAAATATGGACTCAGAGAAACAGATAAACGTTTAAATAGG
CTTAAAAAGTTAGGTGACAGCAGCAAAAATTCAGACAGTCAATCTGTCAGCTCTAACACT
GATGCAGATACCACTCAGGAAAAAAACAATGCAAGTAAGTAA
Restriction Sites NotI-NotI
ACCN NM_016028
Insert Size 2400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_016028.4.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016028.4, NP_057112.3
RefSeq Size 2711 bp
RefSeq ORF 1182 bp
Locus ID 51111
UniProt ID Q4FZB7
Cytogenetics 11q13.2
Domains SET
Protein Families Druggable Genome
Protein Pathways Lysine degradation
Summary This gene encodes a protein that contains a SET domain. SET domains appear to be protein-protein interaction domains that mediate interactions with a family of proteins that display similarity with dual-specificity phosphatases (dsPTPases). The function of this gene has not been determined. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) has an alternate 3' exon and utilizes an upstream stop codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:SUV420h1 (KMT5B) (NM_016028) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221306 SUV420H1 (Myc-DDK-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 10 ug
$457.00
RC221306L1 Lenti-ORF clone of SUV420H1 (Myc-DDK-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 10 ug
$757.00
RC221306L2 Lenti-ORF clone of SUV420H1 (mGFP-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 10 ug
$757.00
RC221306L3 Lenti-ORF clone of SUV420H1 (Myc-DDK-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 10 ug
$757.00
RC221306L4 Lenti-ORF clone of SUV420H1 (mGFP-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 10 ug
$757.00
RG221306 SUV420H1 (tGFP-tagged) - Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.