KCNJ14 (NM_170720) Human Untagged Clone

SKU
SC310393
KCNJ14 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KCNJ14
Synonyms IRK4; KIR2.4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310393 representing NM_170720.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCTGGCCAGGGCCCTACGCCGCCTCAGCGGCGCCCTGGATTCGGGAGACAGCCGGGCGGGCGAT
GAAGAGGAGGCCGGGCCCGGGTTGTGCCGCAACGGGTGGGCGCCGGCACCGGTGCAGTCACCCGTGGGC
CGGCGCCGCGGTCGCTTCGTCAAGAAAGACGGGCACTGCAACGTGCGTTTCGTAAACCTGGGTGGCCAG
GGCGCGCGCTACCTGAGCGACCTGTTCACCACATGCGTGGACGTGCGCTGGCGCTGGATGTGCCTGCTC
TTCTCCTGCTCCTTCCTCGCCTCCTGGCTGCTCTTCGGCCTGGCCTTCTGGCTCATTGCCTCGCTGCAC
GGCGACCTGGCCGCCCCGCCACCGCCCGCGCCCTGCTTCTCACACGTGGCCAGCTTCCTGGCCGCCTTC
CTCTTCGCGCTGGAGACGCAGACGTCCATCGGCTACGGCGTGCGCAGCGTCACCGAGGAGTGCCCGGCC
GCTGTGGCCGCCGTGGTGCTGCAGTGCATTGCCGGCTGCGTGCTCGACGCCTTCGTCGTGGGTGCTGTC
ATGGCCAAGATGGCCAAACCCAAGAAGCGCAACGAGACGCTGGTCTTCAGCGAGAACGCCGTCGTGGCG
CTGCGCGACCACCGCCTCTGCCTCATGTGGCGCGTCGGCAACCTGCGCCGCAGCCACCTGGTCGAGGCC
CACGTGCGTGCCCAGCTGCTGCAGCCCCGTGTGACCCCAGAGGGTGAGTACATCCCGCTGGACCACCAG
GATGTGGATGTGGGCTTTGATGGAGGCACCGATCGTATCTTCCTCGTGTCCCCCATCACCATCGTCCAT
GAGATCGACTCTGCCAGTCCTCTGTATGAGCTAGGACGTGCCGAGCTGGCCAGGGCTGACTTTGAGCTG
GTGGTCATTCTCGAGGGGATGGTTGAGGCCACAGCCATGACCACACAGTGTCGCTCGTCCTACCTCCCT
GGTGAACTGCTCTGGGGCCATCGTTTTGAGCCAGTTCTCTTCCAGCGTGGCTCCCAGTATGAGGTCGAC
TATCGCCACTTCCATCGCACTTATGAGGTCCCAGGGACACCGGTCTGCAGTGCTAAGGAGCTGGATGAA
CGGGCAGAGCAGGCTTCCCACAGCCTCAAGTCTAGTTTCCCCGGCTCTCTGACTGCATTTTGTTATGAG
AATGAACTTGCTCTGAGCTGCTGCCAGGAGGAAGATGAGGACGATGAGACTGAGGAAGGGAATGGGGTG
GAAACAGAAGATGGGGCTGCTAGCCCCCGAGTTCTCACACCAACCCTGGCGCTGACCCTGCCTCCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_170720
Insert Size 1311 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_170720.1
RefSeq Size 3120 bp
RefSeq ORF 1311 bp
Locus ID 3770
Cytogenetics 19q13.33
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 47.8 kDa
Summary Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel, and probably has a role in controlling the excitability of motor neurons. [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (2) represents the longer transcript and differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:KCNJ14 (NM_170720) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216744 KCNJ14 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC216744L1 Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC216744L2 Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2, mGFP tagged 10 ug
$757.00
RC216744L3 Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC216744L4 Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2, mGFP tagged 10 ug
$757.00
RG216744 KCNJ14 (tGFP-tagged) - Human potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.