NEK3 (NM_152720) Human Untagged Clone

SKU
SC310308
NEK3 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2
$519.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NEK3
Synonyms HSPK36
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310308 representing NM_152720.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGACTACATGGTCCTGAGAATGATTGGGGAGGGCTCCTTCGGCAGAGCTCTTTTGGTTCAGCAT
GAAAGCAGTAATCAGATGTTTGCCATGAAAGAAATAAGGCTTCCCAAGTCTTTCTCTAATACACAGAAT
TCTAGGAAGGAGGCTGTTCTTTTAGCCAAAATGAAACACCCTAATATTGTTGCCTTCAAAGAATCATTT
GAAGCTGAAGGACACTTGTATATTGTGATGGAATACTGTGATGGAGGGGATCTAATGCAAAAGATTAAA
CAGCAGAAAGGAAAGTTATTTCCTGAAGACATGATACTTAATTGGTTTACCCAAATGTGCCTTGGAGTA
AATCACATTCACAAGAAACGTGTGCTACACAGAGATATCAAGTCCAAGAATATCTTCCTCACTCAGAAT
GGAAAAGTGAAATTGGGAGACTTTGGATCTGCCCGTCTTCTCTCCAATCCGATGGCATTTGCTTGTACC
TATGTGGGAACTCCTTATTATGTGCCTCCAGAAATTTGGGAAAACCTGCCTTATAACAATAAAAGTGAC
ATCTGGTCCTTGGGTTGCATCCTGTATGAACTCTGTACCCTTAAGCATCCATTTCAGGCAAATAGTTGG
AAAAATCTTATCCTCAAAGTATGTCAAGGGTGCATCAGTCCACTGCCGTCTCATTACTCCTATGAACTT
CAGTTCCTAGTCAAGCAGATGTTTAAAAGGAATCCCTCACATCGCCCCTCGGCTACAACGCTTCTCTCT
CGAGGCATCGTAGCTCGGCTTGTCCAGAAGTGCTTACCCCCCGAGATCATCATGGAATATGGTGAGGAA
GTATTAGAAGAAATAAAAAATTCGAAGCATAACACACCAAGAAAAAAAACAAACCCCAGCAGAATCAGG
ATAGCTTTGGGAAATGAAGCAAGCACAGTGCAAGAGGAAGAACAAGATAGAAAGGGTAGCCATACTGAT
TTGGAAAGCATTAATGAAAATTTAGTTGAAAGTGCATTGAGAAGAGTAAACAGAGAAGAAAAAGGTAAT
AAGTCAGTCCATCTGAGGAAAGCCAGTTCACCAAATCTTCATAGACGACAGTGGGAGAAAAATGTACCC
AATACAGCTCTTACAGCTTTGGAAAATGCATCCATACTCACCTCCAGTTTAACAGCAGAGGACGATAGA
GGTGGTTCTGTAATAAAGTACAGCAAAAATACTACTCGTAAGCAGTGGCTCAAAGAGACCCCTGACACT
TTGTTGAACATCCTTAAGAATGCTGATCTCAGCTTGGCTTTTCAAACATACACAATATATAGACCAGGT
TCAGAAGGGTTCTTGAAAGGCCCCCTGTCTGAAGAAACAGAAGCATCGGACAGTGTTGATGGAGGTCAC
GATTCTGTCATTTTGGATCCAGAGCGACTTGAGCCTGGGCTAGATGAGGAGGACACGGACTTTGAGGAG
GAAGATGACAACCCCGACTGGGTGTCAGAGCTGAAGAAGCGAGCTGGATGGCAAGGCCTGTGCGACAGA
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_152720
Insert Size 1521 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152720.2
RefSeq Size 2424 bp
RefSeq ORF 1521 bp
Locus ID 4752
UniProt ID P51956
Cytogenetics 13q14.3
Domains pkinase, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase
MW 57.7 kDa
Summary This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Two functional alleles for this gene have been identified in humans. The reference genome assembly (GRCh38) represents a functional allele that is associated with the inclusion of an additional coding exon in protein-coding transcripts, compared to an alternate functional allele that lacks the exon. [provided by RefSeq, Sep 2019]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:NEK3 (NM_152720) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205775 NEK3 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2 10 ug
$471.00
RC205775L1 Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, Myc-DDK-tagged 10 ug
$771.00
RC205775L2 Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, mGFP tagged 10 ug
$771.00
RC205775L3 Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, Myc-DDK-tagged 10 ug
$771.00
RC205775L4 Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, mGFP tagged 10 ug
$771.00
RG205775 NEK3 (tGFP-tagged) - Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2 10 ug
$489.00 MSRP $671.00 MSRP $671.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.