beta TRCP2 (FBXW11) (NM_033644) Human Untagged Clone

SKU
SC310293
FBXW11 (untagged)-Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2
$543.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol beta TRCP2
Synonyms BTRC2; BTRCP2; FBW1B; Fbw11; FBXW1B; Hos; NEDJED
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310293 representing NM_033644.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCCGACTCGGTGATTGAGGACAAGACCATCGAGCTCATGAACACTTCAGTTATGGAAGATCAA
AATGAAGATGAGTCCCCAAAGAAAAATACTCTTTGGCAGATAAGTAATGGAACATCATCTGTGATCGTC
TCCAGAAAGAGGCCATCAGAAGGAAACTATCAAAAAGAAAAAGACTTGTGTATTAAATATTTTGACCAG
TGGTCTGAATCAGATCAAGTGGAATTTGTGGAACATCTTATTTCACGAATGTGTCATTATCAGCATGGA
CATATTAACTCTTACCTGAAGCCCATGTTGCAGCGGGACTTTATTACCGCTTTACCAGAGCAAGGCTTA
GATCACATAGCAGAAAACATTCTTTCGTACCTGGATGCCAGGTCTCTGTGTGCAGCAGAGCTGGTATGT
AAAGAATGGCAGCGAGTGATCTCAGAAGGAATGCTTTGGAAGAAGCTGATTGAACGAATGGTACGCACT
GATCCCCTATGGAAAGGACTTTCAGAAAGAAGAGGGTGGGATCAGTACCTGTTTAAAAACAGACCCACA
GATGGCCCTCCAAATTCATTTTATAGGTCATTATACCCAAAGATTATCCAGGATATAGAGACTATAGAA
TCTAACTGGCGGTGTGGACGACACAACTTGCAGAGGATTCAGTGCCGCTCTGAAAATAGTAAAGGTGTC
TACTGTTTACAGTACGATGATGAAAAAATTATCAGTGGCCTACGAGATAATTCTATTAAGATATGGGAT
AAAACCAGCCTGGAATGTTTGAAAGTGTTAACAGGACACACAGGCTCTGTCCTCTGTCTGCAGTATGAT
GAGCGTGTCATTGTAACTGGCTCTTCAGATTCTACGGTGAGAGTGTGGGATGTGAACACGGGTGAAGTT
CTTAACACATTGATCCACCACAATGAGGCTGTATTGCACTTACGCTTCAGCAATGGACTGATGGTGACC
TGTTCCAAGGACCGCTCCATTGCTGTGTGGGACATGGCTTCTGCGACCGACATCACTTTACGCCGTGTC
CTGGTTGGCCACCGGGCTGCCGTCAATGTAGTAGACTTTGACGACAAGTACATCGTGTCTGCCTCTGGT
GACAGGACCATCAAAGTCTGGAGCACGAGCACCTGTGAATTTGTTCGTACTCTCAATGGGCACAAGCGG
GGCATTGCCTGTCTCCAGTACAGGGATCGCCTGGTTGTTAGTGGATCATCAGATAATACCATTAGGCTC
TGGGATATTGAATGTGGTGCCTGTTTAAGAGTCCTAGAGGGACATGAAGAATTGGTCCGATGCATCCGG
TTTGATAACAAGAGGATTGTCAGTGGGGCCTATGATGGGAAAATTAAAGTTTGGGACTTGCAAGCTGCT
CTTGACCCTCGAGCCCCAGCAAGCACATTGTGTTTGCGCACATTGGTGGAACATTCTGGACGTGTGTTT
CGGCTCCAGTTTGATGAGTTTCAGATCATCAGCAGCTCCCATGATGACACTATTTTGATTTGGGATTTC
TTAAATGTGCCTCCCAGTGCCCAGAATGAGACCCGTTCTCCCTCCAGAACATACACTTACATCTCTAGA
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_033644
Insert Size 1590 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033644.2
RefSeq Size 4536 bp
RefSeq ORF 1590 bp
Locus ID 23291
UniProt ID Q9UKB1
Cytogenetics 5q35.1
Domains F-box, WD40
Protein Families Druggable Genome
Protein Pathways Hedgehog signaling pathway, Oocyte meiosis, Ubiquitin mediated proteolysis, Wnt signaling pathway
MW 60.9 kDa
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 3. This variant encodes a shorter isoform (B), compared to isoform C.
Write Your Own Review
You're reviewing:beta TRCP2 (FBXW11) (NM_033644) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204407 FBXW11 (Myc-DDK-tagged)-Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2 10 ug
$492.00
RC204407L1 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2, Myc-DDK-tagged 10 ug
$792.00
RC204407L2 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2, mGFP tagged 10 ug
$792.00
RC204407L3 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2, Myc-DDK-tagged 10 ug
$792.00
RC204407L4 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2, mGFP tagged 10 ug
$792.00
RG204407 FBXW11 (tGFP-tagged) - Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 2 10 ug
$489.00 MSRP $692.00 MSRP $692.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.