SNX21 (NM_152897) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SNX21 |
Synonyms | C20orf161; dJ337O18.4; PP3993; SNX-L; SNXL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC309695 representing NM_152897.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCACCGTGGGACGCAGGAGGGTGCCATGGCCTCCCGGCTCCTGCACCGGCTGCGGCACGCCTTGGCC GGCGACGGCCCCGGGGAGGCGGCGGCCAGTCCAGAGGCCGAGCAGTTTCCGGAGAGCTCAGAGCTGGAG GACGACGACGCCGAGGGCCTGTCCTCCCGACTCAGCGGCACCCTCAGCTTCACCAGCGCCGAGGACGAC GAGGACGACGAGGACGAGGACGACGAGGAGGCTGGCCCTGACCAGCTGCCCCTCGGGGATGGGACGTCA GGAGAAGACGCAGAACGGAGCCCCCCACCTGATGGGCAGTGGGGCAGTCAGCTCCTGGCGCGGCAGCTG CAGGATTTCTGGAAGAAGTCCCGGAACACCTTGGCACCCCAGCGGCTGCTCTTCGAAGTGACCAGCGCT AACGTTGTCAAGGACCCGCCCTCCAAGTACGTGCTCTACACCCTCGCCGTGATCGGCCCAGGACCGCCA GATTGCCAGCCAGCCCAGATCTCTCGCCGTTACTCGGACTTTGAGCGGCTGCACCGAAACCTGCAGCGG CAATTCCGGGGCCCAATGGCTGCCATCTCCTTCCCCCAGTCTCACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_152897 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_152897.2 |
RefSeq Size | 1921 bp |
RefSeq ORF | 600 bp |
Locus ID | 90203 |
UniProt ID | Q969T3 |
Cytogenetics | 20q13.12 |
Protein Families | Druggable Genome |
MW | 21.8 kDa |
Summary | This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks a segment of the coding region, which leads to a frameshift, compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus that lacks a PX domain, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205765 | SNX21 (Myc-DDK-tagged)-Human sorting nexin family member 21 (SNX21), transcript variant 2 | 10 ug |
$300.00
|
|
RC205765L1 | Lenti ORF clone of Human sorting nexin family member 21 (SNX21), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC205765L2 | Lenti ORF clone of Human sorting nexin family member 21 (SNX21), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RC205765L3 | Lenti ORF clone of Human sorting nexin family member 21 (SNX21), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC205765L4 | Lenti ORF clone of Human sorting nexin family member 21 (SNX21), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG205765 | SNX21 (tGFP-tagged) - Human sorting nexin family member 21 (SNX21), transcript variant 2 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.