RFC4 (NM_181573) Human Untagged Clone

SKU
SC309555
RFC4 (untagged)-Human replication factor C (activator 1) 4, 37kDa (RFC4), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RFC4
Synonyms A1; RFC37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309555 representing NM_181573.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAAGCATTTCTTAAAGGTACATCCATCAGTACTAAACCCCCGCTGACCAAGGATCGAGGAGTAGCT
GCCAGTGCGGGAAGTAGCGGAGAGAACAAGAAAGCCAAACCCGTTCCCTGGGTGGAAAAATATCGCCCA
AAATGTGTGGATGAAGTTGCTTTCCAGGAAGAAGTGGTTGCAGTGCTGAAAAAATCTTTAGAAGGAGCA
GATCTTCCTAATCTCTTGTTTTACGGACCACCTGGAACTGGAAAAACATCCACTATTTTGGCAGCAGCT
AGAGAACTCTTTGGGCCTGAACTTTTCCGATTAAGAGTTCTTGAGTTAAATGCATCTGATGAACGTGGA
ATACAAGTAGTTCGAGAGAAAGTGAAAAATTTTGCTCAATTAACTGTGTCAGGAAGTCGCTCAGATGGG
AAGCCGTGTCCGCCTTTTAAGATTGTGATTCTGGATGAAGCAGATTCTATGACCTCAGCTGCTCAGGCA
GCTTTAAGACGTACCATGGAGAAGGAGTCGAAAACCACCCGATTCTGTCTTATCTGTAACTATGTCAGT
CGAATAATTGAACCCCTGACCTCTAGATGTTCAAAATTCCGCTTCAAGCCTCTGTCAGATAAAATTCAA
CAGCAGCGATTACTAGACATTGCCAAGAAGGAAAATGTCAAAATTAGTGATGAGGGAATAGCTTATCTT
GTTAAAGTGTCAGAAGGAGACTTAAGAAAAGCCATTACATTTCTTCAAAGCGCTACTCGATTAACAGGT
GGAAAGGAGATCACAGAGAAAGTGATTACAGACATTGCCGGGGTAATACCAGCTGAGAAAATTGATGGA
GTATTTGCTGCCTGTCAGAGTGGCTCTTTTGACAAACTAGAAGCTGTGGTCAAGGATTTAATAGATGAG
GGTCATGCAGCAACTCAGCTCGTCAATCAACTCCATGATGTGGTTGTAGAAAATAACTTATCTGATAAA
CAGAAGTCTATTATCACAGAAAAACTTGCCGAAGTTGACAAATGCCTAGCAGATGGTGCTGATGAACAT
TTGCAACTCATCAGCCTTTGTGCAACTGTGATGCAGCAGTTATCTCAGAATTGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_181573
Insert Size 1092 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181573.2
RefSeq Size 1486 bp
RefSeq ORF 1092 bp
Locus ID 5984
UniProt ID P35249
Cytogenetics 3q27.3
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
MW 39.7 kDa
Summary The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.
Write Your Own Review
You're reviewing:RFC4 (NM_181573) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211392 RFC4 (Myc-DDK-tagged)-Human replication factor C (activator 1) 4, 37kDa (RFC4), transcript variant 2 10 ug
$457.00
RC211392L3 Lenti ORF clone of Human replication factor C (activator 1) 4, 37kDa (RFC4), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC211392L4 Lenti ORF clone of Human replication factor C (activator 1) 4, 37kDa (RFC4), transcript variant 2, mGFP tagged 10 ug
$757.00
RG211392 RFC4 (tGFP-tagged) - Human replication factor C (activator 1) 4, 37kDa (RFC4), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.