HYAL1 (NM_153281) Human Untagged Clone

SKU
SC309152
HYAL1 (untagged)-Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HYAL1
Synonyms HYAL-1; LUCA1; MPS9; NAT6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309152 representing NM_153281.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGCCCACCTGCTTCCCATCTGCGCCCTCTTCCTGACCTTACTCGATATGGCCCAAGGCTTTAGG
GGCCCCTTGCTACCCAACCGGCCCTTCACCACCGTCTGGAATGCAAACACCCAGTGGTGCCTGGAGAGG
CACGGTGTGGACGTGGATGTCAGTGTCTTCGATGTGGTAGCCAACCCAGGGCAGACCTTCCGCGGCCCT
GACATGACAATTTTCTATAGCTCCCAGCTGGGCACCTACCCCTACTACACGCCCACTGGGGAGCCTGTG
TTTGGTGGTCTGCCCCAGAATGCCAGCCTGATTGCCCACCTGGCCCGCACATTCCAGGACATCCTGGCT
GCCATACCTGCTCCTGACTTCTCAGGGCTGGCAGTCATCGACTGGGAGGCATGGCGCCCACGCTGGGCC
TTCAACTGGGACACCAAGGACATTTACCGGCAGCGCTCACGGGCACTGGTACAGGCACAGCACCCTGAT
TGGCCAGCTCCTCAGGTGGAGGCAGTAGCCCAGGACCAGTTCCAGGGAGCTGCACGGGCCTGGATGGCA
GGCACCCTCCAGCTGGGGCGGGCACTGCGTCCTCGCGGCCTCTGGGGCTTCTATGGCTTCCCTGACTGC
TACAACTATGACTTTCTAAGCCCCAACTACACCGGCCAGTGCCCATCAGGCATCCGTGCCCAAAATGAC
CAGCTAGGGTGGCTGTGGGGCCAGAGCCGTGCCCTCTATCCCAGCATCTACATGCCCGCAGTGCTGGAG
GGCACAGGGAAGTCACAGATGTATGTGCAACACCGTGTGGCCGAGGCATTCCGTGTGGCTGTGGCTGCT
GGTGACCCCAATCTGCCGGTGCTGCCCTATGTCCAGATCTTCTATGACACGACAAACCACTTTCTGCCC
CTGGATGAGCTGGAGCACAGCCTGGGGGAGAGTGCGGCCCAGGGGGCAGCTGGAGTGGTGCTCTGGGTG
AGCTGGGAAAATACAAGAACCAAGGAATCATGTCAGGCCATCAAGGAGTATATGGACACTACACTGGGG
CCCTTCATCCTGAACGTGACCAGTGGGGCCCTTCTCTGCAGTCAAGCCCTGTGCTCCGGCCATGGCCGC
TGTGTCCGCCGCACCAGCCACCCCAAAGCCCTCCTCCTCCTTAACCCTGCCAGTTTCTCCATCCAGCTC
ACGCCTGGTGGTGGGCCCCTGAGCCTGCGGGGTGCCCTCTCACTTGAAGATCAGGCACAGATGGCTGTG
GAGTTCAAATGTCGATGCTACCCTGGCTGGCAGGCACCGTGGTGTGAGCGGAAGAGCATGTGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_153281
Insert Size 1308 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153281.1
RefSeq Size 2370 bp
RefSeq ORF 1308 bp
Locus ID 3373
UniProt ID Q12794
Cytogenetics 3p21.31
Protein Families Secreted Protein
Protein Pathways Glycosaminoglycan degradation, Lysosome, Metabolic pathways
MW 48.4 kDa
Summary This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) represents the longest transcript and encodes the longest isoform (1). Variants 7 and 8 both encode the same isoform (1).
Write Your Own Review
You're reviewing:HYAL1 (NM_153281) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212549 HYAL1 (Myc-DDK-tagged)-Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8 10 ug
$457.00
RC212549L1 Lenti ORF clone of Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8, Myc-DDK-tagged 10 ug
$757.00
RC212549L2 Lenti ORF clone of Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8, mGFP tagged 10 ug
$757.00
RC212549L3 Lenti ORF clone of Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8, Myc-DDK-tagged 10 ug
$757.00
RC212549L4 Lenti ORF clone of Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8, mGFP tagged 10 ug
$757.00
RG212549 HYAL1 (tGFP-tagged) - Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 8 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.