SHOX (NM_000451) Human Untagged Clone

SKU
SC309059
SHOX (untagged)-Human short stature homeobox (SHOX), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SHOX
Synonyms GCFX; PHOG; SHOXY; SS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309059 representing NM_000451.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAGCTCACGGCTTTTGTATCCAAGTCTTTTGACCAGAAAAGCAAGGACGGTAACGGCGGAGGC
GGAGGCGGCGGAGGTAAGAAGGATTCCATTACGTACCGGGAAGTTTTGGAGAGCGGACTGGCGCGCTCC
CGGGAGCTGGGGACGTCGGATTCCAGCCTCCAGGACATCACGGAGGGCGGCGGCCACTGCCCGGTGCAT
TTGTTCAAGGACCACGTAGACAATGACAAGGAGAAACTGAAAGAATTCGGCACCGCGAGAGTGGCAGAA
GGGATTTATGAATGCAAAGAGAAGCGCGAGGACGTGAAGTCGGAGGACGAGGACGGGCAGACCAAGCTG
AAACAGAGGCGCAGCCGCACCAACTTCACGCTGGAGCAGCTGAACGAGCTCGAGCGACTCTTCGACGAG
ACCCATTACCCCGACGCCTTCATGCGCGAGGAGCTCAGCCAGCGCCTGGGGCTCTCCGAGGCGCGCGTG
CAGGTTTGGTTCCAGAACCGGAGAGCCAAGTGCCGCAAACAAGAGAATCAGATGCATAAAGGCGTCATC
TTGGGCACAGCCAACCACCTAGACGCCTGCCGAGTGGCACCCTACGTCAACATGGGAGCCTTACGGATG
CCTTTCCAACAGGTCCAGGCTCAGCTGCAGCTGGAAGGCGTGGCCCACGCGCACCCGCACCTGCACCCG
CACCTGGCGGCGCACGCGCCCTACCTGATGTTCCCCCCGCCGCCCTTCGGGCTGCCCATCGCGTCGCTG
GCCGAGTCCGCCTCGGCCGCCGCCGTGGTCGCCGCCGCCGCCAAAAGCAACAGCAAGAATTCCAGCATC
GCCGACCTGCGGCTCAAGGCGCGGAAGCACGCGGAGGCCCTGGGGCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_000451
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000451.3
RefSeq Size 3757 bp
RefSeq ORF 879 bp
Locus ID 6473
UniProt ID O15266
Cytogenetics X;Y
Domains homeobox, OAR
Protein Families Transcription Factors
MW 32.2 kDa
Summary This gene belongs to the paired homeobox family and is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. Defects in this gene are associated with idiopathic growth retardation and in the short stature phenotype of Turner syndrome patients. This gene is highly conserved across species from mammals to fish to flies. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (SHOXa). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:SHOX (NM_000451) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218605 SHOX (Myc-DDK-tagged)-Human short stature homeobox (SHOX), transcript variant 1 10 ug
$300.00
RC218605L1 Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC218605L2 Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, mGFP tagged 10 ug
$600.00
RC218605L3 Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC218605L4 Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, mGFP tagged 10 ug
$600.00
RG218605 SHOX (tGFP-tagged) - Human short stature homeobox (SHOX), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.