PSCA (NM_005672) Human Untagged Clone

SKU
SC308973
PSCA (untagged)-Human prostate stem cell antigen (PSCA), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PSCA
Synonyms PRO232
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005672 edited
GTGACCATGAAGGCTGTGCTGCTTGCCCTGTTGATGGCAGGCTTGGCCCTGCAGCCAGGC
ACTGCCCTGCTGTGCTACTCCTGCAAAGCCCAGGTGAGCAACGAGGACTGCCTGCAGGTG
GAGAACTGCACCCAGCTGGGGGAGCAGTGCTGGACCGCGCGCATCCGCGCAGTTGGCCTC
CTGACCGTCATCAGCAAAGGCTGCAGCTTGAACTGCGTGGATGACTCACAGGACTACTAC
GTGGGCAAGAAGAACATCACGTGCTGTGACACCGACTTGTGCAACGCCAGCGGGGCCCAT
GCCCTGCAGCCGGCTGCCGCCATCCTTGCGCTGCTCCCTGCACTCGGCCTGCTGCTCTGG
GGACCCGGCCAGCTATAGGCTCTGGGGGGCCCCGCTGCAGCCCACACTGGGTGTGGTGCC
CCAGGCCTCTGTGCCACTCCTCACAGACCTGGCCCAGTGGGAGCCTGTCCTGGTTCCTGA
GGCACATCCTAACGCAAGTCTGACCATGTATGTCTGCACCCCTGTCCCCCACCCTGACCC
TCCCATGGCCCTCTCCAGGACTCCCACCCGGCAGATCAGCTCTAGTGACACAGATCCGCC
TGCAGATGGCCCCTCCAACCCTCTCTGCTGCTGTTTCCATGGCCCAGCATTCTCCACCCT
TAACCCTGTGCTCAGGCACCTCTTCCCCCAGGAAGCCTTCCCTGCCCACCCCATCTATGA
CTTGAGCCAGGTCTGGTCCGTGGTGTCCCCCGCACCCAGCAGGGGACAGGCACTCAGGAG
GGCCCAGTAAAGGCTGAGATGAAGTGGACTGAGTAGAACTGGAGGACAAGAGTCGACGTG
AGTTCCTGGGAGTCTCCAGAGATGGGGCCTGGAGGCCTGGAGGAAGGGGCCAGGCCTCAC
ATTCGTGGGGCTCCCTGAATGGCAGCCTGAGCACAGCGTAGGCCCTTAATAAACACCTGT
TGGATAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_005672
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005672.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005672.3, NP_005663.1
RefSeq Size 1064 bp
RefSeq ORF 372 bp
Locus ID 8000
UniProt ID O43653
Cytogenetics 8q24.3
Summary This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the functional protein.
Write Your Own Review
You're reviewing:PSCA (NM_005672) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209136 PSCA (Myc-DDK-tagged)-Human prostate stem cell antigen (PSCA), transcript variant 1 10 ug
$150.00
RC209136L1 Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC209136L2 Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, mGFP tagged 10 ug
$450.00
RC209136L3 Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC209136L4 Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, mGFP tagged 10 ug
$450.00
RG209136 PSCA (tGFP-tagged) - Human prostate stem cell antigen (PSCA), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.