RASSF8 (NM_007211) Human Untagged Clone

SKU
SC308953
RASSF8 (untagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RASSF8
Synonyms C12orf2; HOJ1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308953 representing NM_007211.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAACTTAAAGTATGGGTGGATGGAGTTCAGAGGATTGTTTGTGGAGTCACTGAAGTCACAACTTGC
CAGGAGGTTGTCATAGCCTTAGCTCAAGCAATAGGTCGAACTGGAAGGTACACCCTTATAGAGAAATGG
AGAGATACTGAAAGACACTTAGCACCTCATGAAAATCCTATCATATCCTTAAACAAATGGGGGCAGTAT
GCTAGTGATGTGCAGCTCATTCTACGACGAACTGGGCCGTCTCTCAGTGAGCGACCCACTTCAGACAGT
GTGGCTCGAATTCCTGAAAGAACTTTATACAGGCAGAGTCTGCCCCCCTTAGCTAAACTGAGGCCTCAG
ATTGACAAATCAATCAAAAGGAGGGAACCGAAAAGGAAATCACTGACATTTACAGGAGGTGCCAAAGGA
TTAATGGACATTTTTGGAAAAGGTAAAGAAACTGAGTTTAAGCAAAAGGTGCTGAATAACTGCAAAACA
ACAGCAGATGAGTTGAAGAAGCTAATCCGTCTGCAGACAGAGAAGCTTCAATCCATTGAGAAACAGCTG
GAATCTAATGAAATAGAAATAAGATTTTGGGAGCAAAAGTATAATTCCAACCTTGAAGAGGAAATTGTC
CGTCTAGAGCAAAAGATCAAAAGAAACGATGTAGAAATTGAGGAGGAAGAATTCTGGGAAAATGAATTA
CAGATTGAACAGGAAAATGAAAAACAGCTGAAGGATCAACTTCAAGAAATAAGACAGAAAATAACAGAA
TGTGAAAACAAATTAAAGGACTATTTGGCACAGATCCGGACTATGGAAAGTGGTCTTGAAGCAGAAAAA
TTGCAACGGGAAGTTCAAGAGGCACAGGTCAATGAGGAAGAGGTTAAAGGAAAGATCGGTAAGGTCAAA
GGGGAGATTGACATTCAAGGCCAGCAGAGTCTGAGGTTGGAAAATGGCATCAAAGCTGTGGAAAGATCT
CTTGGACAAGCCACCAAACGCTTACAGGACAAAGAACAGGAACTGGAGCAGTTGACTAAGGAGTTGCGG
CAAGTCAATCTCCAGCAGTTCATCCAGCAGACAGGGACAAAAGTTACCGTTTTGCCAGCGGAGCCCATT
GAAATAGAGGCCTCACATGCAGACATTGAAAGGGGGATCATCATTCTTTCTGATAAGCAGGAGTGTAAA
GATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_007211
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007211.4
RefSeq Size 2333 bp
RefSeq ORF 1179 bp
Locus ID 11228
UniProt ID Q8NHQ8
Cytogenetics 12p12.1
Domains RA
MW 45.4 kDa
Summary This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (4) differs in both UTRs and in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RASSF8 (NM_007211) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206104 RASSF8 (Myc-DDK-tagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4 10 ug
$457.00
RC206104L1 Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC206104L2 Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4, mGFP tagged 10 ug
$757.00
RC206104L3 Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC206104L4 Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4, mGFP tagged 10 ug
$757.00
RG206104 RASSF8 (tGFP-tagged) - Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 4 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.