NRIP2 (NM_031474) Human Untagged Clone

SKU
SC308766
NRIP2 (untagged)-Human nuclear receptor interacting protein 2 (NRIP2)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NRIP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308766 representing NM_031474.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTATTTATTTTTCCTCTTTCCCTCCCGTGGAGACCCTCCTGTTGGAAAGAGAGCTGCAGCACGGGA
CAGAGACAGGCAGGAAGAAGCAGAGAGGACTCGGTGACGCCCCCACCGAGCAGCCCCTGGCCCACTCCT
CCAGCAGGGGCCATGAGCACCAAGCAGGAGGCCAGGAGAGATGAGGGAGAAGCCAGGACGAGGGGGCAG
GAGGCACAGCTTCGAGACCGAGCCCACCTGAGCCAGCAGCGCCGGCTCAAACAGGCCACCCAGTTCCTG
CACAAGGACTCGGCCGACCTGCTCCCGCTGGACAGCCTCAAGAGGCTCGGCACCTCCAAGGACTTGCAG
CCGCGCAGTGTGATCCAAAGACGCCTGGTGGAGGGAAACCCGAATTGGCTTCAGGGGGAGCCTCCCCGG
ATGCAGGACCTGATTCATGGCCAGGAGAGCAGGAGGAAGACCAGCAGGACAGAGATTCCAGCTCTTCTG
GTCAACTGCAAGTGCCAGGACCAGCTGCTTAGAGTGGCCGTTGACACAGGCACCCAATACAATCGGATC
TCTGCTGGATGTCTCAGCCGCCTGGGGTTAGAGAAAAGGGTCCTAAAAGCCTCAGCTGGGGACCTGGCC
CCTGGGCCCCCAACCCAGGTGGAGCAGTTGGAGCTACAGCTGGGGCAGGAGACTGTGGTGTGCTCGGCA
CAGGTGGTGGATGCTGAGAGTCCTGAATTCTGCCTGGGCCTGCAGACTCTGCTTTCTCTCAAGTGCTGC
ATCGACCTGGAGCACGGAGTGCTGCGGCTGAAAGCCCCGTTCTCAGAGCTACCCTTCCTGCCTTTGTAC
CAAGAGCCTGGCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_031474
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031474.2
RefSeq Size 2787 bp
RefSeq ORF 846 bp
Locus ID 83714
UniProt ID Q9BQI9
Cytogenetics 12p13.33
Protein Families Druggable Genome
MW 31.3 kDa
Summary Down-regulates transcriptional activation by nuclear receptors such as NR1F2.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:NRIP2 (NM_031474) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206240 NRIP2 (Myc-DDK-tagged)-Human nuclear receptor interacting protein 2 (NRIP2) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC206240L1 Lenti ORF clone of Human nuclear receptor interacting protein 2 (NRIP2), Myc-DDK-tagged 10 ug
$600.00
RC206240L2 Lenti ORF clone of Human nuclear receptor interacting protein 2 (NRIP2), mGFP tagged 10 ug
$600.00
RC206240L3 Lenti ORF clone of Human nuclear receptor interacting protein 2 (NRIP2), Myc-DDK-tagged 10 ug
$600.00
RC206240L4 Lenti ORF clone of Human nuclear receptor interacting protein 2 (NRIP2), mGFP tagged 10 ug
$600.00
RG206240 NRIP2 (tGFP-tagged) - Human nuclear receptor interacting protein 2 (NRIP2) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.