TEM8 (ANTXR1) (NM_032208) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | TEM8 |
Synonyms | ATR; GAPO; TEM8 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_032208 edited
ATGGCCACGGCGGAGCGGAGAGCCCTCGGCATCGGCTTCCAGTGGCTCTCTTTGGCCACT CTGGTGCTCATCTGCGCCGGGCAAGGGGGACGCAGGGAGGATGGGGGTCCAGCCTGCTAC GGCGGATTTGACCTGTACTTCATTTTGGACAAATCAGGAAGTGTGCTGCACCACTGGAAT GAAATCTATTACTTTGTGGAACAGTTGGCTCACAAATTCATCAGCCCACAGTTGAGAATG TCCTTTATTGTTTTCTCCACCCGAGGAACAACCTTAATGAAACTGACAGAAGACAGAGAA CAAATCCGTCAAGGCCTAGAAGAACTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATG CATGAAGGATTTGAAAGGGCCAGTGAGCAGATTTATTATGAAAACAGACAAGGGTACAGG ACAGCCAGCGTCATCATTGCTTTGACTGATGGAGAACTCCATGAAGATCTCTTTTTCTAT TCAGAGAGGGAGGCTAATAGGTCTCGAGATCTTGGTGCAATTGTTTACTGTGTTGGTGTG AAAGATTTCAATGAGACACAGCTGGCCCGGATTGCGGACAGTAAGGATCATGTGTTTCCC GTGAATGACGGCTTTCAGGCTCTGCAAGGCATCATCCACTCAATTTTGAAGAAGTCCTGC ATCGAAATTCTAGCAGCTGAACCATCCACCATATGTGCAGGAGAGTCATTTCAAGTTGTC GTGAGAGGAAACGGCTTCCGACATGCCCGCAACGTGGACAGGGTCCTCTGCAGCTTCAAG ATCAATGACTCGGTCACACTCAATGAGAAGCCCTTTTCTGTGGAAGATACTTATTTACTG TGTCCAGCGCCTATCTTAAAAGAAGTTGGCATGAAAGCTGCACTCCAGGTCAGCATGAAC GATGGCCTCTCTTTTATCTCCAGTTCTGTCATCATCACCACCACACACTGTTCTGACGGT TCCATCCTGGCCATCGCCCTGCTGATCCTGTTCCTGCTCCTAGCCCTGGCTCTCCTCTGG TGGTTCTGGCCCCTCTGCTGCACTGTGATTATCAAGGAGGTCCCTCCACCCCCTGCCGAG GAGAGTGAGGAAGAAGATGATGATGGTCTGCCTAAGAAAAAGTGGCCAACGGTAGACGCC TCTTATTATGGTGGGAGAGGCGTTGGAGGCATTAAAAGAATGGAGGTTCGTTGGGGAGAA AAGGGCTCCACAGAAGAAGGTGCTAAGTTGGAAAAGGCAAAGAATGCAAGAGTCAAGATG CCGGAGCAGGAATATGAATTCCCTGAGCCGCGAAATCTCAACAACAATATGCGTCGGCCT TCTTCCCCCCGGAAGTGGTACTCTCCAATCAAGGGAAAACTCGATGCCTTGTGGGTCCTA CTGAGGAAAGGATATGATCGTGTGTCTGTGATGCGTCCACAGCCAGGAGACACGGGGCGC TGCATCAACTTCACCAGGGTCAAGAACAACCAGCCAGCCAAGTACCCACTCAACAACGCC TACCACACCTCCTCGCCGCCTCCTGCCCCCATCTACACTCCCCCACCTCCTGCGCCCCAC TGCCCTCCCCCGCCCCCCAGCGCCCCTACCCCTCCCATCCCGTCCCCACCTTCCACCCTT CCCCCTCCTCCCCAGGCTCCACCTCCCAACAGGGCACCTCCTCCCTCCCGCCCTCCTCCA AGGCCTTCTGTCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_032208 |
Insert Size | 1800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | It was fully sequenced and ORF matches with that of NM_032208.1.MG2771_G02 and G03 are also correct. Pool 10ug DNA for the customer. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_032208.1, NP_115584.1 |
RefSeq Size | 5540 bp |
RefSeq ORF | 1695 bp |
Locus ID | 84168 |
UniProt ID | Q9H6X2 |
Cytogenetics | 2p13.3 |
Protein Families | Druggable Genome, Transmembrane |
Summary | This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) represents the longest transcript and it encodes the longest protein (isoform 1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC222030 | ANTXR1 (Myc-DDK-tagged)-Human anthrax toxin receptor 1 (ANTXR1), transcript variant 1 | 10 ug |
$840.00
|
|
RC222030L1 | Lenti-ORF clone of ANTXR1 (Myc-DDK-tagged)-Human anthrax toxin receptor 1 (ANTXR1), transcript variant 1 | 10 ug |
$1,140.00
|
|
RC222030L2 | Lenti-ORF clone of ANTXR1 (mGFP-tagged)-Human anthrax toxin receptor 1 (ANTXR1), transcript variant 1 | 10 ug |
$1,140.00
|
|
RC222030L3 | Lenti-ORF clone of ANTXR1 (Myc-DDK-tagged)-Human anthrax toxin receptor 1 (ANTXR1), transcript variant 1 | 10 ug |
$1,140.00
|
|
RC222030L4 | Lenti-ORF clone of ANTXR1 (mGFP-tagged)-Human anthrax toxin receptor 1 (ANTXR1), transcript variant 1 | 10 ug |
$1,140.00
|
|
RG222030 | ANTXR1 (tGFP-tagged) - Human anthrax toxin receptor 1 (ANTXR1), transcript variant 1 | 10 ug |
$1,040.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.