Caspase 10 (CASP10) (NM_032977) Human Untagged Clone

SKU
SC308742
CASP10 (untagged)-Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1
$536.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Caspase 10
Synonyms ALPS2; FLICE-2; FLICE2; MCH4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308742 representing NM_032977.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAATCTCAAGGTCAACATTGGTATTCCAGTTCAGATAAAAACTGTAAAGTGAGCTTTCGTGAGAAG
CTTCTGATTATTGATTCAAACCTGGGGGTCCAAGATGTGGAGAACCTCAAGTTTCTCTGCATAGGATTG
GTCCCCAACAAGAAGCTGGAGAAGTCCAGCTCAGCCTCAGATGTTTTTGAACATCTCTTGGCAGAGGAT
CTGCTGAGTGAGGAAGACCCTTTCTTCCTGGCAGAACTCCTCTATATCATACGGCAGAAGAAGCTGCTG
CAGCACCTCAACTGTACCAAAGAGGAAGTGGAGCGACTGCTGCCCACCCGACAAAGGGTTTCTCTGTTT
AGAAACCTGCTCTACGAACTGTCAGAAGGCATTGACTCAGAGAACTTAAAGGACATGATCTTCCTTCTG
AAAGACTCGCTTCCCAAAACTGAAATGACCTCCCTAAGTTTCCTGGCATTTCTAGAGAAACAAGGTAAA
ATAGATGAAGATAATCTGACATGCCTGGAGGACCTCTGCAAAACAGTTGTACCTAAACTTTTGAGAAAC
ATAGAGAAATACAAAAGAGAGAAAGCTATCCAGATAGTGACACCTCCTGTAGACAAGGAAGCCGAGTCG
TATCAAGGAGAGGAAGAACTAGTTTCCCAAACAGATGTTAAGACATTCTTGGAAGCCTTACCGCAGGAG
TCCTGGCAAAATAAGCATGCAGGTAGTAATGGTAACAGAGCCACAAATGGTGCACCAAGCCTGGTCTCC
AGGGGGATGCAAGGAGCATCTGCTAACACTCTAAACTCTGAAACCAGCACAAAGAGGGCAGCTGTGTAC
AGGATGAATCGGAACCACAGAGGCCTCTGTGTCATTGTCAACAACCACAGCTTTACCTCCCTGAAGGAC
AGACAAGGAACCCATAAAGATGCTGAGATCCTGAGTCATGTGTTCCAGTGGCTTGGGTTCACAGTGCAT
ATACACAATAATGTGACGAAAGTGGAAATGGAGATGGTCCTGCAGAAGCAGAAGTGCAATCCAGCCCAT
GCCGACGGGGACTGCTTCGTGTTCTGTATTCTGACCCATGGGAGATTTGGAGCTGTCTACTCTTCGGAT
GAGGCCCTCATTCCCATTCGGGAGATCATGTCTCACTTCACAGCCCTGCAGTGCCCTAGACTGGCTGAA
AAACCTAAACTCTTTTTCATCCAGGCCTGCCAAGGTGAAGAGATACAGCCTTCCGTATCCATCGAAGCA
GATGCTCTGAACCCTGAGCAGGCACCCACTTCCCTGCAGGACAGTATTCCTGCCGAGGCTGACTTCCTA
CTTGGTCTGGCCACTGTCCCAGGCTATGTATCCTTTCGGCATGTGGAGGAAGGCAGCTGGTATATTCAG
TCTCTGTGTAATCATCTGAAGAAATTGGTCCCAAGACATGAAGACATCTTATCCATCCTCACTGCTGTC
AACGATGATGTGAGTCGAAGAGTGGACAAACAGGGAACAAAGAAACAGATGCCCCAGCCTGCTTTCACA
CTAAGGAAAAAACTAGTATTCCCTGTGCCCCTGGATGCACTTTCATTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_032977
Insert Size 1569 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032977.3
RefSeq Size 5906 bp
RefSeq ORF 1569 bp
Locus ID 843
UniProt ID Q92851
Cytogenetics 2q33.1
Domains DED, Peptidase_C14
Protein Families Druggable Genome, Protease
Protein Pathways Apoptosis, RIG-I-like receptor signaling pathway
MW 59 kDa
Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1, also known as caspase-10/d). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Caspase 10 (CASP10) (NM_032977) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206379 CASP10 (Myc-DDK-tagged)-Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1 10 ug
$289.00 MSRP $486.00 MSRP $486.00
RC206379L1 Lenti ORF clone of Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1, Myc-DDK-tagged 10 ug
$786.00
RC206379L2 Lenti ORF clone of Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1, mGFP tagged 10 ug
$786.00
RC206379L3 Lenti ORF clone of Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1, Myc-DDK-tagged 10 ug
$786.00
RC206379L4 Lenti ORF clone of Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1, mGFP tagged 10 ug
$786.00
RG206379 CASP10 (tGFP-tagged) - Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 1 10 ug
$489.00 MSRP $686.00 MSRP $686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.