Methyltransferase like protein 10 (METTL10) (NM_212554) Human Untagged Clone

SKU
SC308650
METTL10 (untagged)-Human methyltransferase like 10 (METTL10)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Methyltransferase like protein 10
Synonyms C10orf138; Efm4; METTL10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308650 representing NM_212554.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTCGGGCGCTGACGGCGGCGGTGGCGCTGCGGTGGCGGCGCGGTCGGACAAGGGCAGTCCCGGG
GAGGACGGTTTCGTCCCGTCGGCGCTGGGGACCCGCGAGCATTGGGATGCTGTCTATGAGAGAGAACTG
CAAACTTTCCGAGAATATGGAGATACAGGTGAAATCTGGTTTGGAGAAGAGAGTATGAATCGACTAATA
AGGTGGATGCAGAAACACAAGATTCCACTGGATGCTTCAGTGCTTGATATTGGAACTGGAAATGGTGTT
TTCCTGGTTGAACTTGCAAAATTTGGTTTCTCTAATATTACTGGAATTGATTACTCTCCTTCTGCAATT
CAGCTTTCTGGAAGTATTATAGAAAAAGAAGGTTTATCTAACATTAAGTTAAAGGTAGAAGACTTTTTG
AATCTCTCCACACAGCTGTCTGGATTTCATATTTGTATTGACAAAGGGACTTTTGATGCCATAAGCCTT
AATCCTGACAATGCAATTGAGAAGAGGAAGCAATATGTGAAATCTCTCTCCAGGGTGTTGAAAGTAAAA
GGCTTTTTTCTAATAACGTCATGTAATTGGACCAAGGAAGAGTTGCTAAATGAATTCAGTGAAGGTTGG
AGTACAGTGGCAGGATTTTGGCTCACTGCAGCCTTGACTTCCTGGGCTCAAGCGATCTTTTCCACTTCA
GCCTCCCGAGTAGGTGGAACTACAGGCACACATCATCATGCCTGGATAATTTTTGTATTTTTAGCAGAG
ACGAGGTTTTGCCATGTTGTCCAGGCTGGTCTGGAACTCCTGGGCTCAAGTGATTCTCCCACCTGGCCT
CCCAAAGTGCTGGGATTATACCATGCCAGGCCCTCGTTGGCATTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_212554
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_212554.3
RefSeq Size 3683 bp
RefSeq ORF 876 bp
Locus ID 399818
UniProt ID Q5JPI9
Cytogenetics 10q26.13
Protein Families Druggable Genome
MW 31.8 kDa
Summary Protein-lysine methyltransferase that selectively catalyzes the trimethylation of EEF1A at 'Lys-318'.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:Methyltransferase like protein 10 (METTL10) (NM_212554) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205517 METTL10 (Myc-DDK-tagged)-Human methyltransferase like 10 (METTL10) 10 ug
$300.00
RC205517L1 Lenti ORF clone of Human methyltransferase like 10 (METTL10), Myc-DDK-tagged 10 ug
$600.00
RC205517L2 Lenti ORF clone of Human methyltransferase like 10 (METTL10), mGFP tagged 10 ug
$600.00
RC205517L3 Lenti ORF clone of Human methyltransferase like 10 (METTL10), Myc-DDK-tagged 10 ug
$600.00
RC205517L4 Lenti ORF clone of Human methyltransferase like 10 (METTL10), mGFP tagged 10 ug
$600.00
RG205517 METTL10 (tGFP-tagged) - Human methyltransferase like 10 (METTL10) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.