Keratinocyte differentiation associated protein (KRTDAP) (NM_207392) Human Untagged Clone

SKU
SC308507
KRTDAP (untagged)-Human keratinocyte differentiation-associated protein (KRTDAP)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Keratinocyte differentiation associated protein
Synonyms KDAP; UNQ467
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308507 representing NM_207392.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGATCCCGGTCCTTCCTGCCGTGGTGCTCCTCTCCCTCCTGGTGCTCCACTCTGCCCAGGGAGCC
ACCCTGGGTGGTCCTGAGGAAGAAAGCACCATTGAGAATTATGCGTCACGACCCGAGGCCTTTAACACC
CCGTTCCTGAACATCGACAAATTGCGATCTGCGTTTAAGGCTGATGAGTTCCTGAACTGGCACGCCCTC
TTTGAGTCTATCAAAAGGAAACTTCCTTTCCTCAACTGGGATGCCTTTCCTAAGCTGAAAGGACTGAGG
AGCGCAACTCCTGATGCCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_207392
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_207392.2
RefSeq Size 500 bp
RefSeq ORF 300 bp
Locus ID 388533
UniProt ID P60985
Cytogenetics 19q13.12
MW 11 kDa
Summary This gene encodes a protein which may function in the regulation of keratinocyte differentiation and maintenance of stratified epithelia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Keratinocyte differentiation associated protein (KRTDAP) (NM_207392) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223306 KRTDAP (Myc-DDK-tagged)-Human keratinocyte differentiation-associated protein (KRTDAP) 10 ug
$150.00
RC223306L1 Lenti ORF clone of Human keratinocyte differentiation-associated protein (KRTDAP), Myc-DDK-tagged 10 ug
$450.00
RC223306L2 Lenti ORF clone of Human keratinocyte differentiation-associated protein (KRTDAP), mGFP tagged 10 ug
$450.00
RC223306L3 Lenti ORF clone of Human keratinocyte differentiation-associated protein (KRTDAP), Myc-DDK-tagged 10 ug
$450.00
RC223306L4 Lenti ORF clone of Human keratinocyte differentiation-associated protein (KRTDAP), mGFP tagged 10 ug
$450.00
RG223306 KRTDAP (tGFP-tagged) - Human keratinocyte differentiation-associated protein (KRTDAP) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.