TNFAIP8L3 (NM_207381) Human Untagged Clone

SKU
SC308496
TNFAIP8L3 (untagged)-Human tumor necrosis factor, alpha-induced protein 8-like 3 (TNFAIP8L3)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TNFAIP8L3
Synonyms TIPE3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308496 representing NM_207381.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAAACCACGGCAAAACCCAAGCACACTGGTTTCCACACTCTGTGAGGCAGAGCCAAAGGGGAAA
CTGTGGGTCAACGGATATGCAGGGACCCAAGGCACAAGGGATGCCACGTTACAAACAAGACTCATCCCC
TTATCTTTTCATCTTCAGAGGGGAAAGGGACTTGCCGCCCCGCTGTCCGCCCTGAGTGCGCCGCGGCTG
CCCGAGCGCCCCGCAGACGGGCGGGTGGCCGTGGACGCCCAGCCAGCAGCCCGCAGCATGGATTCGGAT
TCCGGGGAGCAGAGCGAGGGCGAGCCCGTGACCGCCGCAGGTCCTGATGTTTTTAGTTCAAAGAGTCTT
GCGCTTCAAGCCCAGAAGAAGATTCTGAGCAAAATAGCCAGCAAAACTGTGGCCAACATGTTGATTGAT
GACACCAGCAGCGAGATCTTTGATGAGCTCTACAAAGTCACCAAAGAGCACACACACAACAAGAAGGAA
GCCCACAAGATCATGAAAGACTTAATCAAGGTGGCGATCAAAATCGGGATCCTCTACCGGAACAACCAG
TTTAGCCAAGAGGAGCTGGTTATTGTGGAGAAGTTCCGGAAGAAGCTGAACCAGACCGCCATGACCATT
GTCAGCTTCTATGAGGTGGAATACACCTTCGATAGGAACGTGCTCTCCAATCTCCTGCATGAGTGCAAG
GACCTGGTGCATGAACTGGTGCAGCGGCACCTGACGCCCAGGACCCACGGGCGCATCAACCACGTCTTT
AACCACTTTGCCGATGTGGAGTTCCTCTCCACCCTCTATAGTCTGGATGGAGACTGTAGGCCCAACCTC
AAGAGGATTTGTGAAGGAATCAATAAGTTGCTAGATGAGAAAGTCCTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_207381
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_207381.3
RefSeq Size 2274 bp
RefSeq ORF 879 bp
Locus ID 388121
UniProt ID Q5GJ75
Cytogenetics 15q21.2
MW 32.7 kDa
Summary Acts as a lipid transfer protein. Preferentially captures and shuttles two lipid second messengers, i.e., phosphatidylinositol 4,5- bisphosphate and phosphatidylinositol 3,4,5-trisphosphate and increases their levels in the plasma membrane. Additionally, may also function as a lipid-presenting protein to enhance the activity of the PI3K-AKT and MEK-ERK pathways. May act as a regulator of tumorigenesis through its activation of phospholipid signaling.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:TNFAIP8L3 (NM_207381) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218511 TNFAIP8L3 (Myc-DDK-tagged)-Human tumor necrosis factor, alpha-induced protein 8-like 3 (TNFAIP8L3) 10 ug
$300.00
RC218511L3 Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8-like 3 (TNFAIP8L3), Myc-DDK-tagged 10 ug
$600.00
RC218511L4 Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8-like 3 (TNFAIP8L3), mGFP tagged 10 ug
$600.00
RG218511 TNFAIP8L3 (tGFP-tagged) - Human tumor necrosis factor, alpha-induced protein 8-like 3 (TNFAIP8L3) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.