COMMD6 (NM_203495) Human Untagged Clone

SKU SC308212

COMMD6 (untagged)-Human COMM domain containing 6 (COMMD6), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: COMMD6
• Synonyms: Acrg
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC308212 representing NM_203495.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGAGGCGTCCAGCGAGCCGCCGCTGGATGCTAAGTCCGATGTCACCAACCAGCTTGTAGATTTTCAG; TGGAAACTGGGTATGGCTGTGAGCTCAGACACTTGCAGATCTCTTAAGTATCCTTACGTTGCAGTGATG; CTAAAAGTGGCAGATCATTCAGGCCAAGTAAAGACCAAGTGCTTTGAAATGACGATTCCACAGTTTCAG; AATTTCTACAGACAGTTCAAGGAAATTGCTGCAGTTATTGAAACGGTGTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_203495
• Insert Size: 258 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_203495.3
• RefSeq Size: 1695 bp
• RefSeq ORF: 258 bp
• Locus ID: 170622
• UniProt ID: Q7Z4G1
• Cytogenetics: 13q22.2
• MW: 9.6 kDa
• Summary: COMMD6 belongs to a family of NF-kappa-B (see RELA; MIM 164014)-inhibiting proteins characterized by the presence of a COMM domain (see COMMD1; MIM 607238) (de Bie et al., 2006 [PubMed 16573520]).[supplied by OMIM, Mar 2009]; Transcript Variant: This variant (2) lacks an in-frame coding exon in the 3' region compared to variant 1. The resulting shorter isoform (b) lacks a 13 aa protein segment compared to isoform 1.