NT2NL (NOTCH2NL) (NM_203458) Human Untagged Clone

SKU SC308192

NOTCH2NL (untagged)-Human notch 2 N-terminal like (NOTCH2NL)

Product Data

• Type: Human Untagged Clone
• Target Symbol: NT2NL
• Synonyms: N2N; NOTCH2NL
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_203458 edited; ATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAAGGCTTCTTGGGG; GAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGGACTTGT; GTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAG; GACTGCCAGTACTCGACATCTCATCCATGCTTTGTGTCTCGACCTTGCCTGAATGGCGGC; ACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCGGGTTTACAGGT; AAGGAGTGCCAATGGACCGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAGTACCTGT; ACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGGCTTCACAGGGCAGAAGTGT; GAGACTGATGTCAATGAGTGTGACATTCCAGGACACTGCCAGCATGGTGGCATCTGCCTC; AACCTGCCTGGTTCCTACCAGTGCCAGTGCCTTCAGGGCTTCACAGGCCAGTACTGTGAC; AGCCTGTATGTGCCCTGTGCACCCTCGCCTTGTGTCAATGGAGGCACCTGTCGGCAGACT; GGTGACTTCACTTTTGAGTGCAACTGCCTTCCAGAAACAGTGAGAAGAGGAACAGAGCTC; TGGGAAAGAGACAGGGAAGTCTGGAATGGAAAAGAACACGATGAGAATTAG;
• Restriction Sites: Please inquire
• ACCN: NM_203458
• Insert Size: 1200 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: It is not a varient.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_203458.2, NP_982283.2
• RefSeq Size: 5324 bp
• RefSeq ORF: 711 bp
• Locus ID: 388677
• UniProt ID: Q7Z3S9
• Cytogenetics: 1q21.1
• Summary: Human-specific protein that promotes neural progenitor proliferation and evolutionary expansion of the brain neocortex by regulating the Notch signaling pathway (PubMed:29856954, PubMed:29856955, PubMed:29561261). Able to promote neural progenitor self-renewal, possibly by down-regulating neuronal differentiation genes, thereby delaying the differentiation of neuronal progenitors and leading to an overall final increase in neuronal production (PubMed:29856954). Acts by enhancing the Notch signaling pathway via two different mechanisms that probably work in parallel to reach the same effect (PubMed:29856954). Enhances Notch signaling pathway in a non-cell-autonomous manner via direct interaction with NOTCH2 (PubMed:29856954). Also promotes Notch signaling pathway in a cell-autonomous manner through inhibition of cis DLL1-NOTCH2 interactions, which promotes neuronal differentiation (By similarity).[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.