PDLIM7 (NM_203352) Human Untagged Clone

SKU
SC308131
PDLIM7 (untagged)-Human PDZ and LIM domain 7 (enigma) (PDLIM7), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PDLIM7
Synonyms LMP1; LMP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308131 representing NM_203352.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATTCCTTCAAAGTAGTGCTGGAGGGGCCAGCACCTTGGGGCTTCCGGCTGCAAGGGGGCAAGGAC
TTCAATGTGCCCCTCTCCATTTCCCGGCTCACTCCTGGGGGCAAAGCGGCGCAGGCCGGAGTGGCCGTG
GGTGACTGGGTGCTGAGCATCGATGGCGAGAATGCGGGTAGCCTCACACACATCGAAGCTCAGAACAAG
ATCCGGGCCTGCGGGGAGCGCCTCAGCCTGGGCCTCAGCAGGGCCCAGCCGGTTCAGAGCAAACCGCAG
AAGGTGCAGACCCCTGACAAACAGCCGCTCCGACCGCTGGTCCCAGATGCCAGCAAGCAGCGGCTGATG
GAGAACACAGAGGACTGGCGGCCGCGGCCGGGGACAGGCCAGTCGCGTTCCTTCCGCATCCTTGCCCAC
CTCACAGGCACCGAGTTCATGCAAGACCCGGATGAGGAGCACCTGAAGAAATCAAGCCAGGTGCCCAGG
ACAGAAGCCCCAGCCCCAGCCTCATCTACACCCCAGGAGCCCTGGCCTGGCCCTACCGCCCCCAGCCCT
ACCAGCCGCCCGCCCTGGGCTGTGGACCCTGCGTTTGCCGAGCGCTATGCCCCGGACAAAACGAGCACA
GTGCTGACCCGGCACAGCCAGCCGGCCACGCCCACGCCGCTGCAGAGCCGCACCTCCATTGTGCAGGCA
GCTGCCGGAGGGGTGCCAGGAGGGGGCAGCAACAACGGCAAGACTCCCGTGTGTCACCAGTGCCACAAG
GTCATCCGGGGCCGCTACCTGGTGGCGCTGGGCCACGCGTACCACCCGGAGGAGTTTGTGTGTAGCCAG
TGTGGGAAGGTCCTGGAAGAGGGTGGCTTCTTTGAGGAGAAGGGCGCCATCTTCTGCCCACCATGCTAT
GACGTGCGCTATGCACCCAGCTGTGCCAAGTGCAAGAAGAAGATTACAGGCGAGATCATGCACGCCCTG
AAGATGACCTGGCACGTGCACTGCTTTACCTGTGCTGCCTGCAAGACGCCCATCCGGAACAGGGCCTTC
TACATGGAGGAGGGCGTGCCCTATTGCGAGCGAGACTATGAGAAGATGTTTGGCACGAAATGCCATGGC
TGTGACTTCAAGATCGACGCTGGGGACCGCTTCCTGGAGGCCCTGGGCTTCAGCTGGCATGACACCTGC
TTCGTCTGTGCGATATGTCAGATCAACCTGGAAGGAAAGACCTTCTACTCCAAGAAGGACAGGCCTCTC
TGCAAGAGCCATGCCTTCTCTCATGTGTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII
ACCN NM_203352
Insert Size 1272 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_203352.2
RefSeq Size 1668 bp
RefSeq ORF 1272 bp
Locus ID 9260
UniProt ID Q9NR12
Cytogenetics 5q35.3
Protein Families Druggable Genome
MW 46.5 kDa
Summary The protein encoded by this gene is representative of a family of proteins composed of conserved PDZ and LIM domains. LIM domains are proposed to function in protein-protein recognition in a variety of contexts including gene transcription and development and in cytoskeletal interaction. The LIM domains of this protein bind to protein kinases, whereas the PDZ domain binds to actin filaments. The gene product is involved in the assembly of an actin filament-associated complex essential for transmission of ret/ptc2 mitogenic signaling. The biological function is likely to be that of an adapter, with the PDZ domain localizing the LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2 which is shorter than isoform 1.
Write Your Own Review
You're reviewing:PDLIM7 (NM_203352) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212656 PDLIM7 (Myc-DDK-tagged)-Human PDZ and LIM domain 7 (enigma) (PDLIM7), transcript variant 2 10 ug
$457.00
RC212656L3 Lenti ORF clone of Human PDZ and LIM domain 7 (enigma) (PDLIM7), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC212656L4 Lenti ORF clone of Human PDZ and LIM domain 7 (enigma) (PDLIM7), transcript variant 2, mGFP tagged 10 ug
$757.00
RG212656 PDLIM7 (tGFP-tagged) - Human PDZ and LIM domain 7 (enigma) (PDLIM7), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.