RNF90 (TRIM7) (NM_203297) Human Untagged Clone

SKU
SC308108
TRIM7 (untagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RNF90
Synonyms GNIP; RNF90
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC308108 representing NM_203297.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTCAGGCCACTGGCCAAATGTTATGTCTCCATGTTCAAGTCCCTCTCCAACTTCTCCTCCTGGGA
CAGAAACAGATGGCAGCGGAGCAGGAGAAGGTGGGGGCAGAGTTCCAGGCACTGAGGGCTTTCCTGGTG
GAGCAGGAGGGTCGGCTGCTAGGCCGCCTGGAGGAACTGTCCCGGGAGGTGGCACAGAAGCAGAATGAG
AACCTGGCCCAGCTCGGGGTTGAGATCACCCAGCTGTCCAAGCTCAGCAGCCAGATCCAGGAGACAGCT
CAAAAGCCTGACCTTGACTTTCTCCAGGAATTCAAAAGCACGCTGAGCAGGTGTAGCAATGTGCCTGGC
CCCAAGCCAACCACAGTCTCTTCTGAGATGAAGAATAAAGTCTGGAATGTTTCTCTCAAGACCTTTGTC
TTAAAAGGGATGCTGAAGAAGTTCAAAGAGGACCTTCGGGGAGAGCTGGAGAAAGAGGAGAAAGTGGAG
CTCACCTTGGATCCCGACACGGCCAACCCGCGCCTCATCCTCTCTCTGGATCTTAAGGGCGTGCGCCTC
GGCGAGCGGGCCCAGGACCTGCCCAACCACCCCTGCCGCTTCGACACCAACACCCGCGTCCTGGCGTCC
TGCGGCTTCTCCTCGGGCCGGCATCACTGGGAGGTGGAGGTGGGCTCTAAGGACGGCTGGGCCTTTGGC
GTGGCCCGCGAGAGCGTGCGCCGAAAGGGCCTGACGCCCTTCACTCCCGAGGAGGGCGTCTGGGCCCTG
CAGCTCAACGGCGGCCAGTACTGGGCCGTGACCAGCCCCGAGCGGTCGCCCCTCAGCTGCGGGCACCTG
TCGCGCGTGCGGGTGGCCCTGGACCTGGAGGTGGGAGCCGTGTCCTTCTACGCTGTGGAGGACATGCGC
CACCTCTACACCTTCCGCGTCAACTTCCAGGAGCGCGTGTTCCCGCTTTTCTCTGTTTGCTCCACGGGC
ACCTACTTGCGAATCTGGCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_203297
Insert Size 990 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_203297.1
RefSeq Size 3026 bp
RefSeq ORF 990 bp
Locus ID 81786
UniProt ID Q9C029
Cytogenetics 5q35.3
Protein Families Druggable Genome
MW 37.1 kDa
Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2, also known as GNIP3) differs in the 5' UTR and the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform 2, which has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RNF90 (TRIM7) (NM_203297) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224860 TRIM7 (Myc-DDK-tagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 2 10 ug
$300.00
RC224860L3 Lenti ORF clone of Human tripartite motif containing 7 (TRIM7), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC224860L4 Lenti ORF clone of Human tripartite motif containing 7 (TRIM7), transcript variant 2, mGFP tagged 10 ug
$600.00
RG224860 TRIM7 (tGFP-tagged) - Human tripartite motif containing 7 (TRIM7), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.