RASSF6 (NM_201431) Human Untagged Clone

CAT#: SC308025

RASSF6 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 6 (RASSF6), transcript variant 2


  "NM_201431" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-RASSF6 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RASSF6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RASSF6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308025 representing NM_201431.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCTGGGAGGAGACAGGCGCCGCCCCTGCGCCCGCGCGGGCCTCGGACCTCCCCTACAGGATATCC
TCAGACCATCTCAAAAAGGAGGAAAAGATGACTATGATGGCTCACCAGTACCCCTCTTGGATCTTCATT
AATGAGAAGACATTCATAACCAGGGAACAACTTAATTCTTTATTGAAGACCTATAACATTTTTTATGAG
AACCAGAAAAATCTGCATATTTTATATGGAGAGACTGAAGATGGCAAACTAATTGTTGAAGGAATGCTG
GACATTTTCTGGGGAGTAAAACGACCTATACAGCTAAAAATACAAGATGAGAAGCCATTCTCTTCTTTT
ACTAGTATGAAGTCATCAGACGTCTTCTCCAGCAAAGGAATGACACGCTGGGGGGAATTTGACGATCTC
TATCGTATTAGTGAGCTGGACAGGACCCAGATTCCTATGTCTGAAAAAAGGAATTCCCAGGAAGACTAT
TTATCTTATCACAGCAACACCCTGAAGCCACATGCAAAGGATGAACCAGACTCCCCAGTGCTCTATAGA
ACCATGAGTGAAGCAGCTCTGGTGAGAAAAAGGATGAAGCCTCTGATGATGGACAGAAAAGAAAGACAG
AAAAATAGAGCCTCTATTAATGGACACTTCTATAACCATGAAACATCAATTTTCATTCCAGCCTTTGAA
TCAGAAACTAAGGTCAGAGTAAACAGTAACATGAGAACTGAAGAAGTAATAAAGCAACTTCTCCAAAAA
TTTAAGATTGAAAATAGTCCCCAGGATTTTGCTCTTCACATTATTTTTGCAACAGGAGAACAAAGACGA
CTAAAGAAGACAGACATTCCGCTACTGCAGAGGCTCCTACAGGGACCTTCTGAAAAGAATGCTCGCATT
TTCCTCATGGATAAAGATGCAGAAGAAATTAGCAGTGATGTGGCTCAGTACATTAACTTTCACTTTTCT
CTCTTGGAATCCATTCTTCAAAGATTAAATGAAGAAGAGAAAAGAGAGATTCAAAGAATAGTAACAAAA
TTCAATAAAGAAAAGGCGATTATACTGAAATGTCTTCAAAATAAACTAGTAATAAAAACAGAGACAACA
GTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_201431
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_201431.2
RefSeq Size 5950 bp
RefSeq ORF 1110 bp
Locus ID 166824
UniProt ID Q6ZTQ3
Cytogenetics 4q13.3
MW 43.4 kDa
Gene Summary This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) uses an alternate in-frame exon in the 5' coding region and uses an upstream start codon compared to variant 1. It encodes isoform b which has a longer N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.