KCNRG (NM_199464) Human Untagged Clone

SKU
SC307987
KCNRG (untagged)-Human potassium channel regulator (KCNRG), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KCNRG
Synonyms DLTET
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307987 representing NM_199464.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTAGTCAGGAACTGGTCACTTTGAATGTGGGAGGGAAGATATTCACGACAAGGTTTTCTACGATA
AAGCAGTTTCCTGCTTCTCGTTTGGCACGCATGTTAGATGGCAGAGACCAAGAATTCAAGATGGTTGGT
GGCCAGATTTTTGTAGACAGAGATGGTGATTTGTTTAGTTTCATCTTAGATTTTTTGAGAACTCACCAG
CTTTTATTACCCACTGAATTTTCAGACTATCTTAGGCTTCAGAGAGAGGCTCTTTTCTATGAACTTCGT
TCTCTAGTTGATCTCTTAAACCCATACCTGCTACAGCCAAGACCTGCTCTTGTGGAGGTACATTTCCTA
AGCCGGAACACTCAAGCTTTTTTCAGGGTGTTTGGCTCTTGCAGCAAAACAATTGAGATGCTAACAGGG
AGGATTACAGTGTTTACAGAACAACCTTCAGCGCCGACCTGGAATGGTAACTTTTTCCCTCCTCAGATG
ACCTTACTTCCACTGCCTCCACAAAGACCTTCTTACCATGACCTGGTTTTCCAGTGTGGTTCTGACAGC
ACTACTGATAACCAAACTGGAGTCAGGCTGGTATGCAATGGCGTGATCTCGGCTCACCACAACCTCCGC
CTCTGGGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTATGTTTCTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_199464
Insert Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199464.2
RefSeq Size 1639 bp
RefSeq ORF 690 bp
Locus ID 283518
UniProt ID Q8N5I3
Cytogenetics 13q14.2
MW 25.9 kDa
Summary This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (2) contains an alternate exon which results in a frameshift compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:KCNRG (NM_199464) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212086 KCNRG (Myc-DDK-tagged)-Human potassium channel regulator (KCNRG), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC212086L1 Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212086L2 Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, mGFP tagged 10 ug
$600.00
RC212086L3 Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212086L4 Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, mGFP tagged 10 ug
$600.00
RG212086 KCNRG (tGFP-tagged) - Human potassium channel regulator (KCNRG), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.