BPGM (NM_199186) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | BPGM |
Synonyms | DPGM; ECYT8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC307893 representing NM_199186.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCAAGTACAAACTTATTATGTTAAGACATGGAGAGGGTGCTTGGAATAAGGAGAACCGTTTTTGT AGCTGGGTGGATCAGAAACTCAACAGCGAAGGAATGGAGGAAGCTCGGAACTGTGGGAAGCAACTCAAA GCGTTAAACTTTGAGTTTGATCTTGTATTCACATCTGTCCTTAATCGGTCCATTCACACAGCCTGGCTG ATCCTGGAAGAGCTAGGCCAGGAATGGGTGCCTGTGGAAAGCTCCTGGCGTCTAAATGAGCGTCACTAT GGGGCCTTGATCGGTCTCAACAGGGAGCAGATGGCTTTGAATCATGGTGAAGAACAAGTGAGGCTCTGG AGAAGAAGCTACAATGTAACCCCGCCTCCCATTGAGGAGTCTCATCCTTACTACCAAGAAATCTACAAC GACCGGAGGTATAAAGTATGCGATGTGCCCTTGGATCAACTGCCACGGTCGGAAAGCTTAAAGGATGTT CTGGAGAGACTCCTTCCCTATTGGAATGAAAGGATTGCTCCCGAAGTATTACGTGGCAAAACCATTCTG ATATCTGCTCATGGAAATAGCAGTAGGGCACTCCTAAAACACCTGGAAGGTATCTCAGATGAAGACATC ATCAACATTACTCTTCCTACTGGAGTCCCCATTCTTCTGGAATTGGATGAAAACCTGCGTGCTGTTGGG CCTCATCAGTTCCTGGGTGACCAAGAGGCGATCCAAGCAGCCATTAAGAAAGTAGAAGATCAAGGAAAA GTGAAACAAGCTAAAAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_199186 |
Insert Size | 780 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_199186.2 |
RefSeq Size | 2121 bp |
RefSeq ORF | 780 bp |
Locus ID | 669 |
UniProt ID | P07738 |
Cytogenetics | 7q33 |
Protein Families | Druggable Genome |
Protein Pathways | Glycolysis / Gluconeogenesis, Metabolic pathways |
MW | 30 kDa |
Summary | 2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) represents the longer transcript. Variants 1, 2, and 3 encode the same protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202105 | BPGM (Myc-DDK-tagged)-Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 2 | 10 ug |
$300.00
|
|
RC202105L3 | Lenti ORF clone of Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC202105L4 | Lenti ORF clone of Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG202105 | BPGM (tGFP-tagged) - Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 2 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.