SFTPB (NM_198843) Human Untagged Clone

SKU
SC307793
SFTPB (untagged)-Human surfactant protein B (SFTPB), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SFTPB
Synonyms PSP-B; SFTB3; SFTP3; SMDP1; SP-B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307793 representing NM_198843.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACCAAGCAGGGTACCCAGGCTGCAGAGGTGCCATGGCTGAGTCACACCTGCTGCAGTGGCTGCTG
CTGCTGCTGCCCACGCTCTGTGGCCCAGGCACTGCTGCCTGGACCACCTCATCCTTGGCCTGTGCCCAG
GGCCCTGAGTTCTGGTGCCAAAGCCTGGAGCAAGCATTGCAGTGCAGAGCCCTAGGGCATTGCCTACAG
GAAGTCTGGGGACATGTGGGAGCCGATGACCTATGCCAAGAGTGTGAGGACATCGTCCACATCCTTAAC
AAGATGGCCAAGGAGGCCATTTTCCAGGACACGATGAGGAAGTTCCTGGAGCAGGAGTGCAACGTCCTC
CCCTTGAAGCTGCTCATGCCCCAGTGCAACCAAGTGCTTGACGACTACTTCCCCCTGGTCATCGACTAC
TTCCAGAACCAGACTGACTCAAACGGCATCTGTATGCACCTGGGCCTGTGCAAATCCCGGCAGCCAGAG
CCAGAGCAGGAGCCAGGGATGTCAGACCCCCTGCCCAAACCTCTGCGGGACCCTCTGCCAGACCCTCTG
CTGGACAAGCTCGTCCTCCCTGTGCTGCCCGGGGCCCTCCAGGCGAGGCCTGGGCCTCACACACAGGAT
CTCTCCGAGCAGCAATTCCCCATTCCTCTCCCCTATTGCTGGCTCTGCAGGGCTCTGATCAAGCGGATC
CAAGCCATGATTCCCAAGGGTGCGCTAGCTGTGGCAGTGGCCCAGGTGTGCCGCGTGGTACCTCTGGTG
GCGGGCGGCATCTGCCAGTGCCTGGCTGAGCGCTACTCCGTCATCCTGCTCGACACGCTGCTGGGCCGC
ATGCTGCCCCAGCTGGTCTGCCGCCTCGTCCTCCGGTGCTCCATGGATGACAGCGCTGGCCCAAGGTCG
CCGACAGGAGAATGGCTGCCGCGAGACTCTGAGTGCCACCTCTGCATGTCCGTGACCACCCAGGCCGGG
AACAGCAGCGAGCAGGCCATACCACAGGCAATGCTCCAGGCCTGTGTTGGCTCCTGGCTGGACAGGGAA
AAGTGCAAGCAATTTGTGGAGCAGCACACGCCCCAGCTGCTGACCCTGGTGCCCAGGGGCTGGGATGCC
CACACCACCTGCCAGGCCCTCGGGGTGTGTGGGACCATGTCCAGCCCTCTCCAGTGTATCCACAGCCCC
GACCTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_198843
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198843.2
RefSeq Size 2854 bp
RefSeq ORF 1182 bp
Locus ID 6439
UniProt ID P07988
Cytogenetics 2p11.2
Protein Families Druggable Genome, Secreted Protein
MW 43.3 kDa
Summary This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
Transcript Variant: This variant (2) lacks an internal segment in the 3' UTR, as compared to variant 1. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:SFTPB (NM_198843) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224088 SFTPB (Myc-DDK-tagged)-Human surfactant protein B (SFTPB), transcript variant 2 10 ug
$457.00
RC224088L3 Lenti ORF clone of Human surfactant protein B (SFTPB), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC224088L4 Lenti ORF clone of Human surfactant protein B (SFTPB), transcript variant 2, mGFP tagged 10 ug
$757.00
RG224088 SFTPB (tGFP-tagged) - Human surfactant protein B (SFTPB), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.