RAB43 (NM_198490) Human Untagged Clone

SKU SC307720

RAB43 (untagged)-Human RAB43, member RAS oncogene family (RAB43), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: RAB43
• Synonyms: RAB11B; RAB41
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC307720 representing NM_198490.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGCAGGGCCGGGCCCAGGCCCGGGGGACCCGGACGAGCAGTACGATTTCCTGTTCAAGCTGGTGCTG; GTGGGCGACGCAAGCGTGGGCAAGACGTGCGTGGTGCAGCGCTTCAAGACCGGCGCCTTCTCGGAGCGC; CAGGGAAGCACCATCGGCGTCGACTTCACCATGAAGACGCTGGAGATCCAGGGCAAGCGGGTCAAGCTG; CAGATCTGGGACACGGCCGGCCAGGAGCGGTTCCGCACCATCACCCAGAGCTACTACCGCAGTGCCAAT; GGGGCCATCCTTGCCTACGACATCACCAAGAGGAGCTCCTTCCTGTCGGTGCCTCACTGGATTGAGGAT; GTGAGGAAGTATGCGGGCTCCAACATTGTGCAGCTGCTGATCGGGAACAAGTCAGACCTCAGCGAGCTT; CGGGAGGTCTCCTTGGCTGAGGCACAGAGCCTGGCTGAGCACTATGACATCCTGTGTGCCATTGAGACG; TCTGCCAAGGACTCGAGCAACGTGGAGGAGGCCTTCCTGAGGGTGGCCACGGAGCTCATCATGCGGCAC; GGGGGCCCCTTGTTCAGCGAGAAGAGCCCCGACCACATCCAGCTGAACAGCAAGGACATCGGAGAAGGC; TGGGGCTGCGGGTGCTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_198490
• Insert Size: 639 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_198490.2
• RefSeq Size: 4498 bp
• RefSeq ORF: 639 bp
• Locus ID: 339122
• UniProt ID: Q86YS6
• Cytogenetics: 3q21.3
• Protein Families: Druggable Genome
• MW: 23.3 kDa
• Summary: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. The low intrinsic GTPase activity of RAB43 is activated by USP6NL. Involved in retrograde transport from the endocytic pathway to the Golgi apparatus. Involved in the transport of Shiga toxin from early and recycling endosomes to the trans-Golgi network. Required for the structural integrity of the Golgi complex. Plays a role in the maturation of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1-5 all encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.