MORN5 (NM_198469) Human Untagged Clone

SKU
SC307710
MORN5 (untagged)-Human MORN repeat containing 5 (MORN5)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MORN5
Synonyms C9orf18; C9orf113
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307710 representing NM_198469.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTACACAGGGAGCAAATATATCGGGGAATATGTAGATGGGAGGATGGAGGGCAAAGCCAAGTAC
ATCCTCCCTACCGAAACAATATATGTTGGGGAAATGAAGGATGGCATGTTTCACGGCGAGGGAACCCTG
TACTTCCCCAGCGGAAGCCAATACGACGCCATTTGGGAAAACGGATTGGCCATAAAGGGCACATATACG
TTCTCAGATGGGCTGCACTATGATGAGAAAAACTGGCATTACTGCGACGGCTATGATCGGAGGTTTTAC
ACAGAGATCCTCAATGGCTTGAAGCCTGCAGGTATGGCTCAACTCACCAATATGGACCCACCTAGAAAA
ATCCCCAAGGGCTATTACGATTGTGGAGACGGCTTCTATAACCCAGTCACGAGGGTAGTCAAGGACTAT
AGGAACCGCTTTCTAAGAAACGCAGATGATGACGAGCATGAGTGGATCACCCGTACCTGTCGAAAGGGC
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_198469
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198469.3
RefSeq Size 727 bp
RefSeq ORF 486 bp
Locus ID 254956
UniProt ID Q5VZ52
Cytogenetics 9q33.2
Protein Families Druggable Genome
MW 18.7 kDa
Write Your Own Review
You're reviewing:MORN5 (NM_198469) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218659 MORN5 (Myc-DDK-tagged)-Human MORN repeat containing 5 (MORN5) 10 ug
$150.00
RC218659L3 Lenti ORF clone of Human MORN repeat containing 5 (MORN5), Myc-DDK-tagged 10 ug
$450.00
RC218659L4 Lenti ORF clone of Human MORN repeat containing 5 (MORN5), mGFP tagged 10 ug
$450.00
RG218659 MORN5 (tGFP-tagged) - Human MORN repeat containing 5 (MORN5) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.