GDPD1 (NM_182569) Human Untagged Clone

SKU
SC307438
GDPD1 (untagged)-Human glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GDPD1
Synonyms GDE4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307438 representing NM_182569.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGTCCACTGCGGCTTTTTACCTTCTCTCTACGCTAGGAGGATACTTGGTGACCTCATTCTTGTTG
CTTAAATACCCGACCTTGCTGCACCAGAGAAAGAAGCAGCGATTCCTCAGTAAACACATCTCTCACCGC
GGAGGTGCTGGAGAAAATTTGGAGAATACAATGGCAGCCTTTCAGCATGCGGTTAAAATCGGAACTGAT
ATGCTAGAATTGGACTGCCATATCACAAAAGATGAACAAGTTGTAGTGTCACATGATGAGAATCTAAAG
AGAGCAACTGGGGTCAATGTAAACATCTCTGATCTCAAATACTGTGAGCTCCCACCTTACCTTGGCAAA
CTGGATGTCTCATTTCAAAGAGCATGCCAGTGTGAAGGAAAAGATAACCGAATTCCATTACTGAAGGAA
GTTTTTGAGGCCTTTCCTAACACTCCCATTAACATCGATATCAAAGTCAACAACAATGTGCTGATTAAG
AAGGTTTCAGAGTTGGTGAAGCGGTATAATCGAGAACACTTAACAGTGTGGGGTAATGCCAATTATGAA
ATTGTAGAAAAGTGCTACAAAGAGAATTCAGATATTCCTATACTCTTCAGTCTACAACGTGTCCTGCTC
ATTCTTGGCCTTTTCTTCACTGGCCTCTTGCCCTTTGTGCCCATTCGAGAACAGTTTTTTGAAATCCCA
ATGCCTTCTATTATACTGAAGCTAAAAGAACCACACACCATGTCCAGAAGTCAAAAGTTTCTCATCTGG
CTTTCTGATCTCTTACTAATGAGGAAAGCTTTGTTTGACCACCTAACTGCTCGAGGCATTCAAGTGTAT
ATTTGGGTATTAAATGAAGAACAAGAATACAAAAGAGCTTTTGATTTGGGAGCAACTGGGGTGATGACA
GACTATCCAACAAAGCTTAGGGATTTTTTACATAACTTTTCAGCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_182569
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_182569.3
RefSeq Size 3296 bp
RefSeq ORF 945 bp
Locus ID 284161
UniProt ID Q8N9F7
Cytogenetics 17q22
Protein Families Transmembrane
MW 36.2 kDa
Summary This gene encodes a member of the glycerophosphodiester phosphodiesterase family of enzymes that catalyze the hydrolysis of deacylated glycerophospholipids to glycerol phosphate and alcohol. The encoded protein is localized to the cytoplasm and concentrates near the perinuclear region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:GDPD1 (NM_182569) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223431 GDPD1 (Myc-DDK-tagged)-Human glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 1 10 ug
$300.00
RC223431L3 Lenti ORF clone of Human glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC223431L4 Lenti ORF clone of Human glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG223431 GDPD1 (tGFP-tagged) - Human glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.