UBE2D3 (NM_181893) Human Untagged Clone
SKU
SC307395
UBE2D3 (untagged)-Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 9
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | UBE2D3 |
Synonyms | E2(17)KB3; UBC4/5; UBCH5C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC307395 representing NM_181893.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTTCTAACCGAAAGTGCCTTTCAAAAGAACTTAGTGATTTGGCCCGTGACCCTCCAGCACAATGT TCTGCAGGTCCAGTTGGGGATGATATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCA TATCAAGGCGGTGTATTCTTTTTGACAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTT GCATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTCGATATTCTAAGA TCACAGTGGTCGCCTGCTTTAACAATTTCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCA AACCCAGATGACCCCCTAGTGCCAGAGATTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGA ATATCTCGGGAATGGACTCAGAAGTATGCCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_181893 |
Insert Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_181893.2 |
RefSeq Size | 3646 bp |
RefSeq ORF | 450 bp |
Locus ID | 7323 |
UniProt ID | P61077 |
Cytogenetics | 4q24 |
Protein Pathways | Ubiquitin mediated proteolysis |
MW | 16.9 kDa |
Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (9) lacks two consecutive 5' exons, but has an alternate 5' exon, which contains an upstream in-frame start codon, as compared to variant 1. It encodes isoform 3, which has a distinct and two aa longer N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC218977 | UBE2D3 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 9 | 10 ug |
$150.00
|
|
RC218977L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 9, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC218977L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 9, mGFP tagged | 10 ug |
$450.00
|
|
RG218977 | UBE2D3 (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 9 | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.