ERAS (NM_181532) Human Untagged Clone

SKU
SC307300
ERAS (untagged)-Human ES cell expressed Ras (ERAS)
$300.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ERAS
Synonyms HRAS2; HRASP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_181532 edited
CTGAGCTGCCTGCTGGGGTCATGGAGCTGCCAACAAAGCCTGGCACCTTCGACCTGGGCC
TGGCCACATGGAGCCCTTCCTTCCAGGGGGAAACCCACCGGGCTCAGGCACGCCGCAGGG
ATGTTGGCAGGCAGCTGCCTGAGTACAAGGCTGTGGTGGTGGGCGCCAGTGGCGTGGGCA
AGAGTGCGCTGACCATCCAGCTGAACCACCAGTGCTTCGTGGAGGACCACGACCCCACCA
TCCAGGATTCCTACTGGAAGGAGTTGACCCTGGACAGTGGGGACTGCATTCTGAATGTGC
TGGACACAGCAGGGCAGGCCATCCATAGGGCCCTGCGTGACCAGTGCCTGGCTGTCTGTG
ATGGTGTGCTGGGCGTCTTCGCTCTCGATGACCCCTCGTCTCTGATCCAGCTGCAGCAGA
TATGGGCCACCTGGGGCCCTCACCCCGCCCAGCCCCTTGTCCTCGTGGGCAACAAGTGTG
ACCTTGTGACCACTGCTGGAGATGCTCATGCCGCTGCTGCAGCCCTCGCACACAGCTGGG
GGGCCCACTTCGTGGAGACCTCGGCCAAAACACGGCAAGGCGTGGAGGAGGCCTTTTCCC
TGCTGGTCCATGAGATCCAGAGGGTCCAGGAGGCCATGGCGAAGGAGCCCATGGCAAGGT
CCTGTAGGGAGAAGACCCGGCACCAGAAGGCCACCTGCCACTGTGGCTGCTCTGTGGCCT
GAAGGTCTTGGCCAAGAAATGTAGACCTTTCCCCAGGCCAGGGTGA
Restriction Sites Please inquire
ACCN NM_181532
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_181532.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181532.2, NP_853510.1
RefSeq Size 1266 bp
RefSeq ORF 702 bp
Locus ID 3266
UniProt ID Q7Z444
Cytogenetics Xp11.23
Protein Families Druggable Genome
Summary This gene encodes a constitutively active member of the small GTPase Ras protein family. The encoded protein activates the phosphatidylinositol 3-kinase signal transduction pathway in undifferentiated stem cells, but is not expressed in differentiated cells. This gene may be involved in cancer and chemotherapy resistance. [provided by RefSeq, Dec 2012]
Write Your Own Review
You're reviewing:ERAS (NM_181532) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210965 ERAS (Myc-DDK-tagged)-Human ES cell expressed Ras (ERAS) 10 ug
$300.00
RC210965L1 Lenti ORF clone of Human ES cell expressed Ras (ERAS), Myc-DDK-tagged 10 ug
$600.00
RC210965L2 Lenti ORF clone of Human ES cell expressed Ras (ERAS), mGFP tagged 10 ug
$600.00
RC210965L3 Lenti ORF clone of Human ES cell expressed Ras (ERAS), Myc-DDK-tagged 10 ug
$600.00
RC210965L4 Lenti ORF clone of Human ES cell expressed Ras (ERAS), mGFP tagged 10 ug
$600.00
RG210965 ERAS (tGFP-tagged) - Human ES cell expressed Ras (ERAS) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.