U1SNRNPBP (SNRNP35) (NM_180699) Human Untagged Clone

SKU
SC307238
SNRNP35 (untagged)-Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol U1SNRNPBP
Synonyms HM-1; U1SNRNPBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307238 representing NM_180699.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAACCAGCTAACATGAACGATTGGATGCCCATCGCCAAGGAGTATGATCCACTCAAAGCGGGCAGC
ATTGATGGCACCGATGAAGACCCACACGACCGCGCGGTCTGGAGGGCAATGCTGGCACGATATGTCCCC
AACAAAGGTGTCATAGGAGATCCCCTCCTCACCCTGTTTGTGGCCAGACTAAACTTGCAGACCAAGGAG
GACAAATTAAAGGAAGTCTTTTCCCGCTATGGTGACATCCGGCGGCTTCGGCTGGTCAGGGACTTGGTC
ACAGGTTTTTCAAAGGGCTACGCCTTCATCGAATACAAGGAGGAGCGTGCCGTGATCAAAGCTTACCGA
GATGCTGATGGCCTGGTTATTGACCAGCATGAGATATTTGTGGACTACGAGCTGGAAAGGACTCTCAAA
GGGTGGATCCCTCGGCGACTTGGAGGCGGTCTTGGGGGAAAAAAGGAGTCTGGGCAACTGAGATTTGGG
GGACGGGACCGGCCTTTTCGAAAACCTATTAACTTGCCAGTTGTTAAAAACGACCTCTATAGAGAGGGA
AAACGGGAAAGGCGGGAGCGATCTCGATCCCGAGAAAGACACTGGGACTCGAGGACAAGGGATCGAGAC
CATGACAGGGGCCGGGAGAAGAGATGGCAAGAAAGAGAGCCGACCAGGGTGTGGCCCGACAATGACTGG
GAGAGAGAGAGGGACTTCAGAGATGACAGGATCAAGGGGAGGGAGAAGAAGGAAAGAGGCAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_180699
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_180699.3
RefSeq Size 1070 bp
RefSeq ORF 756 bp
Locus ID 11066
UniProt ID Q16560
Cytogenetics 12q24.31
MW 30 kDa
Summary The protein encoded by this gene is a homolog of the U1-snRNP binding protein. The N-terminal half contains a RNA recognition motif and the C-terminal half is rich in Arg/Asp and Arg/Glu dipeptides, which is a characteristic of a variety of splicing factors. This protein is a component of the U11/U12 small nuclear ribonucleoproteins (snRNP) that form part of the U12-type spliceosome. Alternative splicing results in multiple transcript variants encoding two distinct isoforms and representing a non-protein coding variant. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (3) includes an alternate exon and initiates translation at an alternate start codon, compared to variant 2. The full extent of the 5' UTR of this variant has not been determined. The encoded isoform (b) has a longer N-terminus, compared to isoform a.
Write Your Own Review
You're reviewing:U1SNRNPBP (SNRNP35) (NM_180699) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203746 SNRNP35 (Myc-DDK-tagged)-Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 3 10 ug
$300.00
RC203746L3 Lenti ORF clone of Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC203746L4 Lenti ORF clone of Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 3, mGFP tagged 10 ug
$600.00
RG203746 SNRNP35 (tGFP-tagged) - Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.