LCE3E (NM_178435) Human Untagged Clone

SKU
SC307178
LCE3E (untagged)-Human late cornified envelope 3E (LCE3E)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LCE3E
Synonyms LEP17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307178 representing NM_178435.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCTGCCAGCAGAACCAGAAGCAGTGCCAACCCCCACCCAAGTGCCCCTCACCCAAGTGTCCCCCA
AAGAACCCAGTACAGTGTCTGCCTCCAGCTTCCTCTGGCTGTGCCCCAAGCTCTGGGGGCTGTGGCCCT
AGCTCCGAGGGCGGCTGCTTCCTGAACCACCACAGGCGCCACCACCGATGCCGGCGCCAGAGGTCCAAC
TCCTGTGACAGGGGCAGTGGTCAGCAAGGCGGGGGCTCTGGCTGCTGCCACGGTTCTGGGGGCTGCTGC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_178435
Insert Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178435.3
RefSeq Size 547 bp
RefSeq ORF 279 bp
Locus ID 353145
UniProt ID Q5T5B0
Cytogenetics 1q21.3
MW 9.5 kDa
Summary Precursors of the cornified envelope of the stratum corneum.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:LCE3E (NM_178435) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213561 LCE3E (Myc-DDK-tagged)-Human late cornified envelope 3E (LCE3E) 10 ug
$150.00
RC213561L3 Lenti ORF clone of Human late cornified envelope 3E (LCE3E), Myc-DDK-tagged 10 ug
$450.00
RC213561L4 Lenti ORF clone of Human late cornified envelope 3E (LCE3E), mGFP tagged 10 ug
$450.00
RG213561 LCE3E (tGFP-tagged) - Human late cornified envelope 3E (LCE3E) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.