MRPL52 (NM_178336) Human Untagged Clone

SKU
SC307155
MRPL52 (untagged)-Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 1
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MRPL52
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307155 representing NM_178336.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCTTTAGGGACTGTTCTCTTCACAGGTGTCCGGAGGCTGCACTGCAGCGTAGCCGCTTGGGCG
GGCGGCCAGTGGCGACTACAGCAGGGACTGGCTGCCAACCCCTCCGGCTACGGGCCCCTTACCGAGCTC
CCAGACTGGTCATATGCGGATGGCCGCCCTGCTCCCCCAATGAAAGGCCAGCTTCGAAGAAAAGCTGAA
AGGGAGACGTTTGCAAGACGAGTTGTACTGCTGTCACAGGAAATGGACGCTGGATTACAAGCATGGCAG
CTCAGGCAGCAGAAGTTGCAGGAAGAACAAAGGAAGCAGGAAAATGCTCTTAAACCCAAAGGGGCTTCA
CTGAAGAGCCCACTTCCAAGTCAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_178336
Insert Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178336.2
RefSeq Size 1123 bp
RefSeq ORF 372 bp
Locus ID 122704
UniProt ID Q86TS9
Cytogenetics 14q11.2
MW 13.7 kDa
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which has no bacterial homolog. Multiple transcript variants encoding different protein isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is the predominant transcript and it encodes the longest isoform (a).
Write Your Own Review
You're reviewing:MRPL52 (NM_178336) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209661 MRPL52 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$150.00
RC209661L3 Lenti ORF clone of Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC209661L4 Lenti ORF clone of Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$450.00
RG209661 MRPL52 (tGFP-tagged) - Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.