T2R50 (TAS2R50) (NM_176890) Human Untagged Clone

SKU
SC307084
TAS2R50 (untagged)-Human taste receptor, type 2, member 50 (TAS2R50)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol T2R50
Synonyms T2R50; T2R51; TAS2R51
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307084 representing NM_176890.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATAACTTTTCTATACATTTTTTTTTCAATTCTAATAATGGTTTTATTTGTTCTCGGAAACTTTGCC
AATGGCTTCATAGCACTGGTAAATTTCATTGACTGGGTGAAGAGAAAAAAGATCTCCTCAGCTGACCAA
ATTCTCACTGCTCTGGCGGTCTCCAGAATTGGTTTGCTCTGGGCATTATTATTAAATTGGTATTTAACT
GTGTTGAATCCAGCTTTTTATAGTGTAGAATTAAGAATTACTTCTTATAATGCCTGGGTTGTAACCAAC
CATTTCAGCATGTGGCTTGCTGCTAACCTCAGCATATTTTATTTGCTCAAGATTGCCAATTTCTCCAAC
CTTCTTTTTCTTCATTTAAAGAGGAGAGTTAGGAGTGTCATTCTGGTGATACTGTTGGGGACTTTGATA
TTTTTGGTTTGTCATCTTCTTGTGGCAAACATGGATGAGAGTATGTGGGCAGAAGAATATGAAGGAAAC
ATGACTGGGAAGATGAAATTGAGGAATACAGTACATCTTTCATATTTGACTGTAACTACCCTATGGAGC
TTCATACCCTTTACTCTGTCCCTGATATCTTTTCTGATGCTAATCTGTTCTCTGTGTAAACATCTCAAG
AAGATGCAGCTCCATGGAGAAGGATCGCAAGATCTCAGCACCAAGGTCCACATAAAAGCTTTGCAAACT
CTGATCTCCTTCCTCTTGTTATGTGCCATTTTCTTTCTATTCCTAATCGTTTCGGTTTGGAGTCCTAGG
AGGCTGCGGAATGACCCGGTTGTCATGGTTAGCAAGGCTGTTGGAAACATATATCTTGCATTCGACTCA
TTCATCCTAATTTGGAGAACCAAGAAGCTAAAACACACCTTTCTTTTGATTTTGTGTCAGATTAGGTGC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_176890
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_176890.2
RefSeq Size 1000 bp
RefSeq ORF 900 bp
Locus ID 259296
UniProt ID P59544
Cytogenetics 12p13.2
Protein Families Transmembrane
Protein Pathways Taste transduction
MW 34.6 kDa
Summary TAS2R50 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). See also TAS2R10 (MIM 604791).[supplied by OMIM, Mar 2008]
Write Your Own Review
You're reviewing:T2R50 (TAS2R50) (NM_176890) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211325 TAS2R50 (Myc-DDK-tagged)-Human taste receptor, type 2, member 50 (TAS2R50) 10 ug
$300.00
RC211325L3 Lenti ORF clone of Human taste receptor, type 2, member 50 (TAS2R50), Myc-DDK-tagged 10 ug
$600.00
RC211325L4 Lenti ORF clone of Human taste receptor, type 2, member 50 (TAS2R50), mGFP tagged 10 ug
$600.00
RG211325 TAS2R50 (tGFP-tagged) - Human taste receptor, type 2, member 50 (TAS2R50) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.