NLRP8 (NM_176811) Human Untagged Clone

CAT#: SC307068

Reviews ()
Write a review

NLRP8 (untagged)-Human NLR family, pyrin domain containing 8 (NLRP8)



  "NM_176811" in other vectors (6)

Reconstitution Protocol

USD 1,004.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Other products for "NLRP8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NLRP8
Synonyms CLR19.2; NALP8; NOD16; PAN4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307068 representing NM_176811.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGACGTGAATCCACCCTCTGACACCCCCATTCCCTTTTCATCCTCCTCCACTCACAGTTCTCAT
ATTCCGCCCTGGACATTCTCTTGCTACCCCGGCTCCCCATGTGAAAATGGGGTCATGCTGTACATGAGA
AACGTGAGCCATGAGGAGCTACAACGGTTCAAGCAGCTCTTACTGACTGAGCTCAGTACTGGCACCATG
CCCATCACCTGGGACCAGGTCGAGACAGCCAGCTGGGCAGAGGTGGTTCATCTCTTGATAGAGCGTTTC
CCTGGACGACGCGCTTGGGATGTGACTTCGAACATCTTTGCCATTATGAACTGTGATAAAATGTGTGTT
GTAGTCCGCAGAGAGATAAATGCCATTCTGCCTACCTTGGAACCAGAGGACTTGAATGTGGGAGAAACA
CAGGTGAATCTGGAGGAAGGAGAATCTGGTAAAATACGGCGGTATAAATCGAATGTGATGGAAAAGTTT
TTCCCCATATGGGACATTACGACTTGGCCTGGAAACCAGAGGGACTTCTTCTACCAAGGTGTACACAGG
CACGAGGAGTACTTACCATGTCTGCTTCTGCCCAAAAGACCCCAGGGTAGACAGCCCAAGACCGTGGCC
ATACAGGGAGCTCCTGGGATCGGAAAAACAATCCTGGCCAAAAAGGTGATGTTTGAGTGGGCCAGAAAC
AAGTTCTACGCCCACAAGCGCTGGTGTGCTTTCTACTTCCATTGCCAAGAGGTGAACCAGACGACAGAC
CAGAGCTTCTCCGAGCTGATTGAGCAAAAGTGGCCTGGATCTCAGGACCTCGTGTCAAAGATTATGTCC
AAACCCGACCAACTTCTGCTGCTCTTGGATGGCTTTGAGGAGCTCACATCTACCCTCATTGACAGACTG
GAGGACCTGAGTGAAGACTGGAGGCAGAAATTGCCTGGGTCTGTCCTACTGAGCAGTTTGCTGAGCAAA
ACGATGCTTCCAGAGGCCACGCTACTGATCATGATAAGATTTACCTCTTGGCAGACATGCAAGCCCTTG
CTGAAATGTCCCTCTCTCGTAACCCTTCCGGGGTTTAATACGATGGAAAAAATCAAGTATTTCCAGATG
TATTTTGGACACACAGAGGAGGGAGACCAAGTCTTGAGTTTCGCCATGGAAAACACCATTCTCTTCTCC
ATGTGCCGGGTCCCTGTGGTTTGCTGGATGGTCTGCTCTGGTCTGAAACAGCAAATGGAGAGAGGAAAC
AATCTCACACAGTCATGTCCAAATGCCACCTCTGTGTTCGTCCGGTATATTTCTAGCTTGTTTCCCACC
AGAGCTGAGAACTTTTCCAGAAAGATCCACCAAGCACAACTGGAAGGTCTGTGTCACTTGGCCGCAGAC
AGCATGTGGCACAGGAAATGGGTGTTAGGTAAAGAAGATCTTGAGGAAGCCAAGCTGGATCAGACGGGA
GTCACCGCCTTCCTTGGCATGAGTATTCTTCGGAGAATTGCAGGTGAGGAAGACCACTATGTCTTTACC
CTCGTGACTTTTCAGGAATTTTTTGCGGCCTTGTTTTATGTTCTCTGTTTCCCACAAAGACTCAAAAAT
TTTCATGTGTTGAGCCACGTGAATATCCAGCGCCTGATAGCGAGTCCCAGAGGAAGCAAAAGCTATCTC
TCTCACATGGGACTTTTCTTATTCGGTTTTCTGAACGAGGCCTGCGCTTCGGCCGTGGAACAGTCATTC
CAATGCAAGGTGTCTTTCGGTAATAAGAGGAAACTGCTGAAAGTCATACCTCTGTTGCATAAATGTGAC
CCACCTTCTCCGGGCAGTGGGGTCCCGCAGTTATTCTACTGTCTGCATGAAATCCGGGAGGAAGCCTTT
GTAAGCCAAGCCCTAAATGATTATCATAAAGTTGTCTTGAGAATTGGCAACAACAAAGAAGTTCAAGTG
TCTGCTTTTTGCCTGAAGCGGTGTCAATATTTGCATGAGGTGGAACTGACCGTCACCCTGAACTTCATG
AACGTGTGGAAGCTCAGCTCCAGCTCCCATCCTGGCTCTGAAGCGCCAGAGAGCAATGGGCTGCATCGT
TGGTGGCAAGACTTATGCTCTGTGTTTGCAACGAATGATAAGCTGGAAGTCCTGACTATGACCAACAGT
GTTTTGGGGCCTCCTTTTTTGAAGGCTCTCGCGGCCGCACTGAGGCACCCTCAGTGCAAACTGCAAAAG
CTACTCCTAAGGCGTGTGAATAGCACCATGTTGAACCAGGACTTAATCGGTGTTTTGACGGGGAACCAG
CATCTGAGATACTTGGAAATACAACATGTGGAAGTGGAGTCCAAAGCTGTGAAGCTTCTATGCAGGGTG
CTGAGATCCCCCCGGTGCCGTCTGCAGTGTCTCAGGTTGGAAGACTGCTTGGCCACCCCTAGAATTTGG
ACTGATCTTGGCAATAATCTTCAAGGTAACGGGCATCTAAAGACTCTCATACTAAGAAAAAACTCCCTG
GAGAACTGTGGGGCGTATTACCTGTCTGTGGCCCAGCTGGAGAGGCTGTCGATAGAGAACTGCAACCTT
ACACAGCTTACTTGTGAAAGCCTTGCCTCCTGTCTCAGGCAGAGTAAGATGCTGACCCACCTGAGCTTG
GCAGAAAACGCCTTGAAAGATGAAGGGGCCAAGCATATTTGGAATGCCCTGCCACACCTGAGATGTCCT
CTGCAGAGGCTGGTACTGAGAAAGTGTGACTTGACCTTTAATTGCTGTCAGGATATGATCTCTGCGCTC
TGTAAAAATAAAACCCTGAAAAGTCTTGACCTAAGTTTTAATAGCCTGAAGGATGATGGGGTGATCCTG
CTGTGTGAGGCCCTGAAGAACCCTGACTGTACATTACAGATCCTGGAGCTGGAAAACTGCCTGTTCACC
TCCATCTGCTGCCAGGCCATGGCTTCCATGCTCCGCAAAAACCAACATCTGAGACATCTGGACTTGAGC
AAGAATGCGATTGGAGTCTATGGTATTCTGACCTTGTGCGAGGCCTTCTCAAGCCAAAAGAAGAGAGAA
GAGGTCATTTTCTGTATTCCTGCCTGGACTCGAATAACTAGCTTCTCCCCAACTCCTCACCCACCCGAC
TTCACGGGAAAAAGTGACTGCCTATCCCAGATTAATCCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_176811
Insert Size 3147 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_176811.2
RefSeq Size 3934 bp
RefSeq ORF 3147 bp
Locus ID 126205
UniProt ID Q86W28
Cytogenetics 19q13.43
MW 119.4 kDa
Gene Summary This gene encodes a member of the nucleotide-binding oligomerization domain/ leucine rich repeat/ pyrin domain containing (NLRP) subfamily, which belongs to the Nod-like receptor family of proteins. NLRP genes play roles in the mammalian innate immune system through inflammasome formation and activation of caspases. In addition, NLRP genes have been found to function during mammalian reproduction. Consistent with a function during human preimplantation development, this gene is expressed at high levels in oocytes with decreased levels in embryos. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.