KRTAP8-1 (NM_175857) Human Untagged Clone

SKU
SC307036
KRTAP8 (untagged)-Human keratin associated protein 8-1 (KRTAP8-1)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KRTAP8-1
Synonyms KAP8.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307036 representing NM_175857.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCTGCGACAACTTCCCCGGGGCTGTCTTCCCAGGATGCTACTGGGGCAGCTATGGCTACCCGCTG
GGATATAGCGTTGGCTGTGGCTATGGCAGCACCTACTCTCCAGTGGGCTATGGCTTCGGCTATGGCTAC
AACGGCTGTGGGGCTTTCGGCTACAGGAGATACTCGCCATTTGCTCTCTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_175857
Insert Size 192 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175857.3
RefSeq Size 573 bp
RefSeq ORF 192 bp
Locus ID 337879
UniProt ID Q8IUC2
Cytogenetics 21q22.11
MW 6.8 kDa
Summary In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:KRTAP8-1 (NM_175857) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218560 KRTAP8 (Myc-DDK-tagged)-Human keratin associated protein 8-1 (KRTAP8-1) 10 ug
$150.00
RC218560L3 Lenti ORF clone of Human keratin associated protein 8-1 (KRTAP8-1), Myc-DDK-tagged 10 ug
$450.00
RC218560L4 Lenti ORF clone of Human keratin associated protein 8-1 (KRTAP8-1), mGFP tagged 10 ug
$450.00
RG218560 KRTAP8 (tGFP-tagged) - Human keratin associated protein 8-1 (KRTAP8-1) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.