DCUN1D3 (NM_173475) Human Untagged Clone

SKU
SC306823
DCUN1D3 (untagged)-Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DCUN1D3
Synonyms 44M2.4; SCCRO3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306823 representing NM_173475.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCAGTGTGTCACCAAGTGTAAGAATCCCTCATCGACCCTGGGCAGCAAAAATGGAGACCGTGAG
CCCAGCAACAAGTCACATAGCAGGAGGGGTGCAGGCCACCGTGAGGAGCAGGTACCACCCTGTGGCAAG
CCAGGTGGAGATATCCTCGTCAACGGGACCAAGAAGGCCGAGGCTGCCACTGAGGCCTGCCAGCTGCCA
ACGTCCTCGGGAGATGCTGGGAGGGAGTCCAAGTCCAATGCCGAGGAGTCTTCCTTGCAAAGATTGGAA
GAACTGTTCAGGCGCTACAAGGATGAGCGGGAAGATGCAATTTTGGAGGAAGGCATGGAGCGCTTTTGC
AATGACCTGTGTGTTGACCCCACAGAATTTCGAGTGCTGCTCTTGGCTTGGAAGTTCCAGGCTGCAACC
ATGTGCAAATTCACCAGGAAGGAGTTTTTTGATGGCTGCAAAGCAATAAGTGCAGACAGCATTGACGGA
ATCTGTGCACGGTTCCCTAGCCTCTTAACAGAAGCCAAACAAGAGGATAAATTCAAGGATCTCTACCGG
TTTACATTTCAGTTTGGCCTGGACTCTGAAGAAGGGCAGCGGTCACTGCATCGGGAAATAGCCATTGCC
CTGTGGAAACTAGTCTTTACCCAGAACAATCCTCCGGTATTGGACCAATGGCTAAACTTCCTAACAGAG
AACCCCTCGGGGATCAAGGGCATCTCCCGGGACACTTGGAACATGTTCCTTAACTTCACTCAGGTGATT
GGCCCTGACCTCAGCAACTACAGTGAAGATGAGGCCTGGCCAAGTCTCTTTGACACCTTTGTGGAGTGG
GAAATGGAGCGAAGGAAAAGAGAAGGGGAAGGGAGAGGTGCACTCAGCTCAGGGCCTGAGGGCTTGTGT
CCCGAGGAGCAGACTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_173475
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173475.3
RefSeq Size 6153 bp
RefSeq ORF 915 bp
Locus ID 123879
UniProt ID Q8IWE4
Cytogenetics 16p12.3
MW 34.3 kDa
Summary Antagonizes DCUN1D1-mediated CUL1 neddylation by sequestering CUL1 at the cell membrane (PubMed:25349211). When overexpressed in transformed cells, may promote mesenchymal to epithelial-like changes and inhibit colony formation in soft agar (PubMed:25349211).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:DCUN1D3 (NM_173475) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208082 DCUN1D3 (Myc-DDK-tagged)-Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3) 10 ug
$300.00
RC208082L1 Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3), Myc-DDK-tagged 10 ug
$600.00
RC208082L2 Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3), mGFP tagged 10 ug
$600.00
RC208082L3 Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3), Myc-DDK-tagged 10 ug
$600.00
RC208082L4 Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3), mGFP tagged 10 ug
$600.00
RG208082 DCUN1D3 (tGFP-tagged) - Human DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) (DCUN1D3) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.