IL36 beta (IL36B) (NM_173178) Human Untagged Clone

SKU
SC306794
IL36B (untagged)-Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL36 beta
Synonyms FIL1; FIL1-(ETA); FIL1H; FILI-(ETA); IL-1F8; IL-1H2; IL1-ETA; IL1F8; IL1H2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306794 representing NM_173178.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACCCACAACGGGAGGCAGCACCCAAATCCTATGCTATTCGTGATTCTCGACAGATGGTGTGGGTC
CTGAGTGGAAATTCTTTAATAGCAGCTCCTCTTAGCCGCAGCATTAAGCCTGTCACTCTTCATTTAATA
GCCTGTAGAGACACAGAATTCAGTGACAAGGAAAAGGGTAATATGGTTTACCTGGGAATCAAGGGAAAA
GATCTCTGTCTCTTCTGTGCAGAAATTCAGGGCAAGCCTACTTTGCAGCTTAAGGAAAAAAATATCATG
GACCTGTATGTGGAGAAGAAAGCACAGAAGCCCTTTCTCTTTTTCCACAATAAAGAAGGCTCCACTTCT
GTCTTTCAGTCAGTCTCTTACCCTGGCTGGTTCATAGCCACCTCCACCACATCAGGACAGCCCATCTTT
CTCACCAAGGAGAGAGGCATAACTAATAACACTAACTTCTACTTAGATTCTGTGGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_173178
Insert Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173178.2
RefSeq Size 1068 bp
RefSeq ORF 474 bp
Locus ID 27177
UniProt ID Q9NZH7
Cytogenetics 2q14.1
Protein Families Druggable Genome, Secreted Protein
MW 17.7 kDa
Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' region, which includes a part of the coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:IL36 beta (IL36B) (NM_173178) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211037 IL36B (Myc-DDK-tagged)-Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2 10 ug
$150.00
RC211037L3 Lenti ORF clone of Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC211037L4 Lenti ORF clone of Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2, mGFP tagged 10 ug
$450.00
RG211037 IL36B (tGFP-tagged) - Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.