Mitochondrial ribosomal protein L11 (MRPL11) (NM_170738) Human Untagged Clone
SKU
SC306692
MRPL11 (untagged)-Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Mitochondrial ribosomal protein L11 |
Synonyms | CGI-113; L11MT; MRP-L11 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC306692 representing NM_170738.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAAAGCTCGGCCGGGCCGCCCGGGGCCTCAGGAAGCCCGAGAGAGGCGTTTCCATCAACCAGTTT TGCAAGGAGTTCAATGAGAGGACAAAGGACATCAAGGAAGGCATTCCTCTGCCTACCAAGATTTTAGTG AAGCCTGACAGGACATTTGAAATTAAGATTGGACAGCCCACTGTTTCCTACTTCCTGAAGGCAGCAGCT GGGATTGAAAAGGGGGCCCGGCAAACAGGGAAAGAGGTGGCAGGCCTGGTGACCTTGAAGCATGTGTAT GAGATTGCCCGCATCAAAGCTCAGGATGAGGCATTTGCCCTGCAGGATGTACCCCTGTCGTCTGTTGTC CGCTCCATCATCGGGTCTGCCCGTTCTCTGGGCATTCGCGTGGTGAAGGACCTCAGTTCAGAAGAGCTT GCAGCTTTCCAGAAGGAACGAGCCATCTTCCTGGCTGCTCAGAAGGAGGCAGATTTGGCTGCCCAAGAA GAAGCTGCCAAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_170738 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_170738.3 |
RefSeq Size | 1544 bp |
RefSeq ORF | 501 bp |
Locus ID | 65003 |
UniProt ID | Q9Y3B7 |
Cytogenetics | 11q13.2 |
MW | 18.2 kDa |
Summary | This nuclear gene encodes a 39S subunit component of the mitochondial ribosome. Alternative splicing results in multiple transcript variants. Pseudogenes for this gene are found on chromosomes 5 and 12. [provided by RefSeq, May 2014] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, which results in an isoform (b) that lacks an internal segment of sequence, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210613 | MRPL11 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 2 | 10 ug |
$150.00
|
|
RC210613L3 | Lenti ORF clone of Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC210613L4 | Lenti ORF clone of Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged | 10 ug |
$450.00
|
|
RG210613 | MRPL11 (tGFP-tagged) - Human mitochondrial ribosomal protein L11 (MRPL11), nuclear gene encoding mitochondrial protein, transcript variant 2 | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.