GSTA5 (NM_153699) Human Untagged Clone

SKU
SC306643
GSTA5 (untagged)-Human glutathione S-transferase alpha 5 (GSTA5)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GSTA5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_153699 edited
GAGACTGCTATCATGGCAGAGAAGCCCAAGCTCCACTACTCCAATGCACGGGGCAGTATG
GAGTCCATTCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTGGAAGAGAAATTTCTAGAA
TCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGGAGTTTGCTGTTCCAGCAAGTACCA
ATGGTTGAGATTGACGGGATGAAGCTGGTGCAGACCAGAGCCATTCTTAACTACATTGCC
AGCAAATACAACCTTTATGGGAAAGACATGAAGGAGAGAGCCCTGATTGATATGTACACA
GAAGGTATAGTAGATTTGACTGAAATGATCCTTCTTCTGCTCATATGTCAACCAGAGGAA
AGAGATGCCAAGACTGCCTTGGTCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTT
GAAAAAGTCTTAAAGAGCCACAGACAAGACTACCTTGTTGGCAACAAGCTGAGCTGGGCT
GACATTCACCTGGTGGAACTTTTCTACTACGTGGAAGAGCTTGACTCGAGTCTTATCTCC
AGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACGGTGAAGAAG
TTTCTGCAGCCTGGCAGCCAGAGAAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCA
AGGAAGATTTTCAGGTTTTAA
Restriction Sites Please inquire
ACCN NM_153699
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation ORF was fully sequenced and the DNA sequence matches with that of NM_153699.1.MG2606_G03 and G07 are also correct. Pool 10 ug of DNA and ship it to the customer.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153699.1, NP_714543.1
RefSeq Size 845 bp
RefSeq ORF 669 bp
Locus ID 221357
UniProt ID Q7RTV2
Cytogenetics 6p12.2
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Summary The glutathione S-transferases (GST; EC 2.5.1.18) catalyze the conjugation of reduced glutathiones and a variety of electrophiles, including many known carcinogens and mutagens. The cytosolic GSTs belong to a large superfamily, with members located on different chromosomes. For additional information on GSTs, see GSTA1 (MIM 138359).[supplied by OMIM, Sep 2008]
Write Your Own Review
You're reviewing:GSTA5 (NM_153699) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215990 GSTA5 (Myc-DDK-tagged)-Human glutathione S-transferase alpha 5 (GSTA5) 10 ug
$300.00
RC215990L1 Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), Myc-DDK-tagged 10 ug
$600.00
RC215990L2 Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), mGFP tagged 10 ug
$600.00
RC215990L3 Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), Myc-DDK-tagged 10 ug
$600.00
RC215990L4 Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), mGFP tagged 10 ug
$600.00
RG215990 GSTA5 (tGFP-tagged) - Human glutathione S-transferase alpha 5 (GSTA5) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.