ODF4 (NM_153007) Human Untagged Clone

SKU
SC306534
ODF4 (untagged)-Human outer dense fiber of sperm tails 4 (ODF4)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ODF4
Synonyms CT134; CT136; OPPO1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306534 representing NM_153007.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGCAGAGTACTCTGGGAATGAGTTCCCCAGGTCAGAAGGAGAAAGAGACCAACATCAGAGACCT
GGAAAGGAAAGGAAGAGTGGGGAGGCAGGATGGGGCACAGGTGAGCTGGGACAAGATGGGAGACTGCTG
TCCTCCACCCTCTCCCTCAGTAGTAACAGGTCCTTGGGCCAGCGCCAGAACTCTCCGCTGCCCTTTCAA
TGGAGAATCACACACAGCTTCCGCTGGATGGCCCAGGTGTTGGCCTCTGAGCTCAGCCTGGTTGCCTTT
ATCCTACTATTGGTCGTGGCCTTCTCCAAGAAATGGCTGGACCTCTCTAGGAGCCTCTTCTACCAGCGC
TGGCCCGTGGATGTCAGCAACAGAATCCACACATCAGCCCACGTTATGTCCATGGGGCTCCTGCACTTT
TACAAATCCAGGAGCTGTTCTGACTTAGAGAATGGGAAAGTCACCTTCATCTTCTCCACCCTCATGCTA
TTCCCCATTAACATCTGGATCTTCGAGTTGGAAAGGAATGTATCCATCCCCATAGGCTGGAGCTATTTC
ATTGGTTGGCTGGTGCTTATCCTATACTTCACCTGCGCGATCCTTTGCTACTTCAACCATAAAAGTTTC
TGGAGTCTGATTCTGAGCCACCCCAGTGGTGCCGTGTCCTGCAGCAGCAGTTTCGGCTCAGTAGAAGAA
TCTCCAAGGGCACAGACGATCACAGACACCCCCATCACCCAGGAGGGAGTCCTGGATCCTGAGCAGAAG
GATACACATGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_153007
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153007.4
RefSeq Size 1149 bp
RefSeq ORF 774 bp
Locus ID 146852
UniProt ID Q2M2E3
Cytogenetics 17p13.1
Protein Families Transmembrane
MW 29.2 kDa
Summary This gene encodes a protein that is localized in the outer dense fibers of the tails of mature sperm. This protein is thought to have some important role in the sperm tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:ODF4 (NM_153007) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211295 ODF4 (Myc-DDK-tagged)-Human outer dense fiber of sperm tails 4 (ODF4) 10 ug
$300.00
RC211295L3 Lenti ORF clone of Human outer dense fiber of sperm tails 4 (ODF4), Myc-DDK-tagged 10 ug
$600.00
RC211295L4 Lenti ORF clone of Human outer dense fiber of sperm tails 4 (ODF4), mGFP tagged 10 ug
$600.00
RG211295 ODF4 (tGFP-tagged) - Human outer dense fiber of sperm tails 4 (ODF4) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.