PIG3 (TP53I3) (NM_147184) Human Untagged Clone

SKU
SC306303
TP53I3 (untagged)-Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PIG3
Synonyms PIG3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306303 representing NM_147184.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTAGCCGTGCACTTTGACAAGCCGGGAGGACCGGAAAACCTCTACGTGAAGGAGGTGGCCAAGCCG
AGCCCGGGGGAGGGTGAAGTCCTCCTGAAGGTGGCGGCCAGCGCCCTGAACCGGGCGGACTTAATGCAG
AGACAAGGCCAGTATGACCCACCTCCAGGAGCCAGCAACATTTTGGGACTTGAGGCATCTGGACATGTG
GCAGAGCTGGGGCCTGGCTGCCAGGGACACTGGAAGATCGGGGACACAGCCATGGCTCTGCTCCCCGGT
GGGGGCCAGGCTCAGTACGTCACTGTCCCCGAAGGGCTCCTCATGCCTATCCCAGAGGGATTGACCCTG
ACCCAGGCTGCAGCCATCCCAGAGGCCTGGCTCACCGCCTTCCAGCTGTTACATCTTGTGGGAAATGTT
CAGGCTGGAGACTATGTGCTAATCCATGCAGGACTGAGTGGTGTGGGCACAGCTGCTATCCAACTCACC
CGGATGGCTGGAGCTATTCCTCTGGTCACAGCTGGCTCCCAGAAGAAGCTTCAAATGGCAGAAAAGCTT
GGAGCAGCTGCTGGATTCAATTACAAAAAAGAGGATTTCTCTGAAGCAACGCTGAAATTCACCAAAGGT
GCTGGAGTTAATCTTATTCTAGACTGCATAGGCGGATCCTACTGGGAGAAGAACGTCAACTGCCTGGCT
CTTGATGGTCGATGGGTTCTCTATGGTCTGATGGGAGGAGGTGACATCAATGGGCCCCTGTTTTCAAAG
CTACTTTTTAAGCGAGGAAGTCTGATCACCAGTTTGCTGAGGTCTAGGGACAATAAGTACAAGCAAATG
CTGGTGAATGCTTTCACGGAGCAAATTCTGCCTCACTTCTCCACGGAGGGCCCCCAACGTCTGCTGCCG
GTTCTGGACAGAATCTACCCAGTGACCGAAATCCAGGAGGCCCATAAGTACATGGAGGCCAACAAGAAC
ATAGGCAAGATCGTCCTGGAACTGCCCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_147184
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_147184.3
RefSeq Size 1643 bp
RefSeq ORF 999 bp
Locus ID 9540
UniProt ID Q53FA7
Cytogenetics 2p23.3
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway
MW 35.5 kDa
Summary The protein encoded by this gene is similar to oxidoreductases, which are enzymes involved in cellular responses to oxidative stresses and irradiation. This gene is induced by the tumor suppressor p53 and is thought to be involved in p53-mediated cell death. It contains a p53 consensus binding site in its promoter region and a downstream pentanucleotide microsatellite sequence. P53 has been shown to transcriptionally activate this gene by interacting with the downstream pentanucleotide microsatellite sequence. The microsatellite is polymorphic, with a varying number of pentanucleotide repeats directly correlated with the extent of transcriptional activation by p53. It has been suggested that the microsatellite polymorphism may be associated with differential susceptibility to cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (2) differs in the 5'UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).
Write Your Own Review
You're reviewing:PIG3 (TP53I3) (NM_147184) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224067 TP53I3 (Myc-DDK-tagged)-Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 2 10 ug
$300.00
RC224067L3 Lenti ORF clone of Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC224067L4 Lenti ORF clone of Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 2, mGFP tagged 10 ug
$600.00
RG224067 TP53I3 (tGFP-tagged) - Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.