Macrophage Inflammatory Protein 3 (CCL23) (NM_145898) Human Untagged Clone

SKU SC306291

CCL23 (untagged)-Human chemokine (C-C motif) ligand 23 (CCL23), transcript variant CKbeta8

Product Data

• Type: Human Untagged Clone
• Target Symbol: Macrophage Inflammatory Protein 3
• Synonyms: CK-BETA-8; Ckb-8; Ckb-8-1; CKb8; hmrp-2a; MIP-3; MIP3; MPIF-1; SCYA23
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC306291 representing NM_145898.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTACTGCCCTTGGATCCCAGGCCCGGGTC; ACAAAAGATGCAGAGACAGAGTTCATGATGTCAAAGCTTCCATTGGAAAATCCAGTACTTCTGGACAGA; TTCCATGCTACTAGTGCTGACTGCTGCATCTCCTACACCCCACGAAGCATCCCGTGTTCACTCCTGGAG; AGTTACTTTGAAACGAACAGCGAGTGCTCCAAGCCGGGTGTCATCTTCCTCACCAAGAAGGGGCGACGT; TTCTGTGCCAACCCCAGTGATAAGCAAGTTCAGGTTTGCATGAGAATGCTGAAGCTGGACACACGGATC; AAGACCAGGAAGAATTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_145898
• Insert Size: 363 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_145898.3
• RefSeq Size: 604 bp
• RefSeq ORF: 363 bp
• Locus ID: 6368
• UniProt ID: P55773
• Cytogenetics: 17q12
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• MW: 13.4 kDa
• Summary: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity on resting T lymphocytes and monocytes, lower activity on neutrophils and no activity on activated T lymphocytes. The protein is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. In addition, the product of this gene is a potent agonist of the chemokine (C-C motif) receptor 1. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]; Transcript Variant: This variant (CKbeta8) uses an alternate, in-frame splice site in the coding region, compared to transcript variant CKbeta8-1. This difference results in a shorter protein (isoform CKbeta8) compared to isoform CKbeta8-1.