C1orf150 (GCSAML) (NM_145278) Human Untagged Clone

SKU
SC306240
GCSAML (untagged)-Human chromosome 1 open reading frame 150 (C1orf150)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1orf150
Synonyms C1orf150
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306240 representing NM_145278.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAAATTATCTCCTGCGAAAACTCAGTTGCCTGGGAGAGAATCAAAAGAAGCCCAAGAAAGGAAAC
CCAGATGAGGAAAGAAAACGGCAGGAAATGACTACATTTGAAAGAAAACTTCAAGATCAAGATAAGAAA
AGCCAAGAAGTTTCATCCACTTCTAATCAGGAAAACGAGAATGGCAGTGGTTCTGAAGAAGTGTGCTAC
ACTGTCATTAATCACATCCCCCATCAGAGATCCTCCCTGAGCTCCAATGATGATGGCTATGAGAACATT
GACTCCCTCACAAGGAAAGTGAGACAGTTTAGAGAAAGGTCAGAGACAGAATATGCCCTTCTTAGGACT
TCTGTTAGTAGGCCTTGTTCCTGCACCCATGAGCATGATTATGAAGTTGTGTTTCCACACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_145278
Insert Size 408 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145278.4
RefSeq Size 3863 bp
RefSeq ORF 408 bp
Locus ID 148823
UniProt ID Q5JQS6
Cytogenetics 1q44
MW 15.7 kDa
Summary This gene encodes a protein thought to be a signaling molecule associated with germinal centers, the sites of proliferation and differentiation of mature B lymphocytes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (1) encodes the longest isoform (a). The 5' UTR splicing pattern has not been determined for this variant. Variants 1 and 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:C1orf150 (GCSAML) (NM_145278) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205104 GCSAML (Myc-DDK-tagged)-Human chromosome 1 open reading frame 150 (C1orf150) 10 ug
$225.00
RC205104L3 Lenti ORF clone of Human chromosome 1 open reading frame 150 (C1orf150), Myc-DDK-tagged 10 ug
$525.00
RC205104L4 Lenti ORF clone of Human chromosome 1 open reading frame 150 (C1orf150), mGFP tagged 10 ug
$525.00
RG205104 GCSAML (tGFP-tagged) - Human chromosome 1 open reading frame 150 (C1orf150) 10 ug
$425.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.