Kallikrein 15 (KLK15) (NM_138564) Human Untagged Clone

SKU
SC306039
KLK15 (untagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Kallikrein 15
Synonyms ACO; HSRNASPH
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_138564, the custom clone sequence may differ by one or more nucleotides
ATGTGGCTTCTCCTCACTCTCTCCTTCCTGCTGGCATCCACAGCAGCCCAGGATGGTGAC
AAGTTGCTGGAAGGTGACGAGTGTGCACCCCACTCCCAGCCATGGCAAGTGGCTCTCTAC
GAGCGTGGACGCTTTAACTGTGGCGCTTCCCTCATCTCCCCACACTGGGTGCTGTCTGCG
GCCCACTGCCAAAGCCGCTTCATGAGAGTGCGCCTGGGAGAGCACAACCTGCGCAAGCGC
GATGGCCCAGAGCAACTACGGACCACGTCTCGGGTCATTCCACACCCGCGCTACGAAGCG
CGCAGCCACCGCAACGACATCATGTTGCTGCGCCTAGTCCAGCCCGCACGCCTGAACCCC
CAGGGTGACTCTGGGGGACCCCTGGTCTGTGGGGGCATCCTGCAGGGCATTGTGTCCTGG
GGTGACGTCCCTTGTGACAACACCACCAAGCCTGGTGTCTATACCAAAGTCTGCCACTAC
TTGGAGTGGATCAGGGAAACCATGAAGAGGAACTGA
Restriction Sites Please inquire
ACCN NM_138564
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138564.1, NP_612631.1
RefSeq Size 1054 bp
RefSeq ORF 516 bp
Locus ID 55554
Cytogenetics 19q13.33
Protein Families Druggable Genome, Protease, Secreted Protein
Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses an alternate splice site on an internal exon and lacks an alternate exon, compared to variant 4. The missing internal segment results in an encoded isoform (3) that lacks an internal region, but shares the same N- and C-termini, compared to isoform 4.
Write Your Own Review
You're reviewing:Kallikrein 15 (KLK15) (NM_138564) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213756 KLK15 (Myc-DDK-tagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC213756L3 Lenti-ORF clone of KLK15 (Myc-DDK-tagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 10 ug
$600.00
RC213756L4 Lenti-ORF clone of KLK15 (mGFP-tagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 10 ug
$600.00
RG213756 KLK15 (tGFP-tagged) - Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.